ID: 1053550918

View in Genome Browser
Species Human (GRCh38)
Location 9:39078714-39078736
Sequence CGGCTCCCCGGCGCGGGAAC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 3, 1: 0, 2: 0, 3: 5, 4: 65}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053550918_1053550930 9 Left 1053550918 9:39078714-39078736 CCAGTTCCCGCGCCGGGGAGCCG 0: 3
1: 0
2: 0
3: 5
4: 65
Right 1053550930 9:39078746-39078768 CCCGCTGCGCAGCGGGCCATAGG 0: 1
1: 2
2: 0
3: 5
4: 58
1053550918_1053550936 25 Left 1053550918 9:39078714-39078736 CCAGTTCCCGCGCCGGGGAGCCG 0: 3
1: 0
2: 0
3: 5
4: 65
Right 1053550936 9:39078762-39078784 CCATAGGGGCCACGTGGCCGCGG 0: 3
1: 0
2: 0
3: 9
4: 81
1053550918_1053550932 10 Left 1053550918 9:39078714-39078736 CCAGTTCCCGCGCCGGGGAGCCG 0: 3
1: 0
2: 0
3: 5
4: 65
Right 1053550932 9:39078747-39078769 CCGCTGCGCAGCGGGCCATAGGG 0: 1
1: 2
2: 0
3: 0
4: 29
1053550918_1053550937 29 Left 1053550918 9:39078714-39078736 CCAGTTCCCGCGCCGGGGAGCCG 0: 3
1: 0
2: 0
3: 5
4: 65
Right 1053550937 9:39078766-39078788 AGGGGCCACGTGGCCGCGGACGG 0: 3
1: 0
2: 0
3: 7
4: 133
1053550918_1053550933 11 Left 1053550918 9:39078714-39078736 CCAGTTCCCGCGCCGGGGAGCCG 0: 3
1: 0
2: 0
3: 5
4: 65
Right 1053550933 9:39078748-39078770 CGCTGCGCAGCGGGCCATAGGGG 0: 1
1: 2
2: 0
3: 1
4: 39
1053550918_1053550925 2 Left 1053550918 9:39078714-39078736 CCAGTTCCCGCGCCGGGGAGCCG 0: 3
1: 0
2: 0
3: 5
4: 65
Right 1053550925 9:39078739-39078761 CGCCGCCCCCGCTGCGCAGCGGG 0: 1
1: 2
2: 0
3: 36
4: 241
1053550918_1053550934 19 Left 1053550918 9:39078714-39078736 CCAGTTCCCGCGCCGGGGAGCCG 0: 3
1: 0
2: 0
3: 5
4: 65
Right 1053550934 9:39078756-39078778 AGCGGGCCATAGGGGCCACGTGG 0: 3
1: 0
2: 0
3: 4
4: 79
1053550918_1053550924 1 Left 1053550918 9:39078714-39078736 CCAGTTCCCGCGCCGGGGAGCCG 0: 3
1: 0
2: 0
3: 5
4: 65
Right 1053550924 9:39078738-39078760 ACGCCGCCCCCGCTGCGCAGCGG 0: 1
1: 2
2: 0
3: 10
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053550918 Original CRISPR CGGCTCCCCGGCGCGGGAAC TGG (reversed) Exonic
900237737 1:1600550-1600572 CGGGTCCCCGCCGCGGGTCCAGG - Intergenic
901279888 1:8026046-8026068 CGGCTCCCCGACGCGAGGGCGGG - Intronic
901426282 1:9183715-9183737 CCGCTCCCCGGGGTGAGAACGGG + Intergenic
901491493 1:9598586-9598608 CGGCCTCCCGGCGCTTGAACTGG - Exonic
902323637 1:15684482-15684504 CCGGCCCCCGGCGCGGGAAGCGG + Exonic
905037957 1:34929713-34929735 CGGCTGCCCTGCGCGGGGGCGGG - Intergenic
905124918 1:35709469-35709491 GGGCTCCCCGGTGGGGGATCTGG - Intergenic
912619517 1:111140562-111140584 CGGAGCGCCGGCGCGGGAGCCGG + Intronic
917962266 1:180154719-180154741 CCGCTCCTGGGCGCGGGAGCGGG - Intergenic
1063115418 10:3068522-3068544 CGGCGCCGCGGCGCGGGCTCCGG + Intronic
1064209086 10:13348137-13348159 CGGCGCCCAGGCGCGGGCCCGGG - Exonic
1069557733 10:69408762-69408784 CGGCTCCCCAGGGCGGGGTCAGG + Intronic
1075207009 10:120456976-120456998 CGGGTGCCCGGCGCGGGCCCAGG + Exonic
1076452699 10:130567665-130567687 CGCCTCCCCGGCGTGGGCAAAGG - Intergenic
1076722468 10:132398724-132398746 GGGACCCCCGGCGTGGGAACTGG + Intronic
1080592590 11:33736512-33736534 CGGCTGCGCGGTGCGGGAGCCGG - Intergenic
1084646775 11:70463571-70463593 CGGCTCCCAGGCCAGGGATCTGG - Intergenic
1100565261 12:95789588-95789610 CTGCTCCCTGGCTCGGTAACTGG - Intronic
1114554833 14:23556037-23556059 CGGCTCCCGGGGGCTGGTACAGG - Exonic
1122750362 14:103928453-103928475 CGGGTCTCCGCGGCGGGAACAGG - Exonic
1124646570 15:31441212-31441234 AGGGTCCCGGGCGCGGGCACCGG - Intergenic
1127546108 15:59995450-59995472 ATGCTCCCCGGCACGGGCACTGG - Intergenic
1131048880 15:89333681-89333703 CAGCGCCCCGGAGCTGGAACCGG + Exonic
1136413759 16:30091535-30091557 GGGCTCCCCACCGTGGGAACGGG - Intronic
1137300380 16:47143477-47143499 CGGGTCCCGGGCGCGGGTAAGGG + Intronic
1141430406 16:83968181-83968203 CCGCTCCCCGGGGCTGGAGCCGG + Intergenic
1141570073 16:84928874-84928896 CGGATCCCCGGCCCAGGACCAGG - Intergenic
1142671218 17:1488224-1488246 CGGCGGCGCGGCCCGGGAACTGG - Intronic
1142709652 17:1716089-1716111 CGGCTCCCCGCTGCGTGACCGGG + Intergenic
1142851311 17:2706124-2706146 CGGCTCTCAGGAGCGGGGACAGG + Intronic
1148079495 17:44959968-44959990 CGGTTCCCTGGCACGGGGACAGG + Exonic
1148848355 17:50541920-50541942 CGGCTCGCCGGCGCTGGGCCTGG + Exonic
1150692531 17:67378118-67378140 CGGACCCCCGGGGCGGGAAGCGG - Intronic
1157279106 18:46334197-46334219 CGGCTCCGGGGCGCGGGCGCGGG - Intronic
1159511263 18:69400843-69400865 CGGCTCCCCGGCGCGGGGGGAGG - Intergenic
1160915887 19:1496307-1496329 TGGCTCCCAGGCCCTGGAACGGG + Exonic
1161682613 19:5687567-5687589 CGGCTCCCTGCGGCGGGAGCTGG + Exonic
1163262270 19:16198329-16198351 CTGCTCCCCGGCGCCGGGGCCGG + Intronic
929452816 2:42048145-42048167 CGGCTCCCCGGCCCCGGCCCCGG - Exonic
943060431 2:183037742-183037764 CGGCTCCCGGCGGCGGGATCGGG - Intronic
948731300 2:239965491-239965513 AGGCTGCCCTGCGAGGGAACGGG - Intronic
1168756775 20:324182-324204 CGGCTCCGCGGCGCGGGGGGCGG - Intergenic
1169065600 20:2692885-2692907 CGGCGGGGCGGCGCGGGAACCGG + Exonic
1170889876 20:20368086-20368108 CGGCTGCCGGGCCCGGGGACAGG + Intergenic
1176123468 20:63464632-63464654 TAGCTCCCCGACGCTGGAACAGG + Intronic
1180154867 21:45972872-45972894 CGGGTCAGCGGCGCCGGAACAGG + Intergenic
1181026741 22:20131522-20131544 CGGCTCCGCGGCCCGGGACCAGG + Intronic
1181256849 22:21568159-21568181 CGGTTCCGCGGCGCGGGCTCCGG - Intronic
954121789 3:48504063-48504085 AGGATCCGCGGCGCGGGGACCGG + Exonic
961775175 3:129279153-129279175 CTGCTCCCCGGAGCGGGGGCCGG - Intronic
963202065 3:142596309-142596331 CGGCTCCCAGGGGAGGGAAAGGG - Intergenic
964720605 3:159764724-159764746 CCGCTCTCCGGCCCGGGAACCGG + Exonic
966878286 3:184335935-184335957 CCGCTCCCCGGAGAGGGAACCGG - Intronic
969040346 4:4290581-4290603 CGGCTCCCAGGCCCGGAACCTGG - Intronic
969417053 4:7067824-7067846 CGGTTCCCCGCCGCGGGACGCGG - Intronic
973293106 4:48489888-48489910 CGGCTTCCCGGTGAGGGAGCGGG + Intergenic
995047670 5:107670138-107670160 GGGCTCCCCGCGCCGGGAACCGG + Intronic
999062830 5:148654207-148654229 CGGCTCCCCAGCGCGGGGGCTGG - Intronic
1002052204 5:176577455-176577477 CGTCTCCCCGGAGCGGGCAGTGG + Exonic
1006770301 6:36547422-36547444 CGTCTCCGCGGCGGGGGACCGGG - Exonic
1011746734 6:90413692-90413714 CCTCTCCCAGGAGCGGGAACAGG - Intergenic
1015181334 6:130365608-130365630 CGGGTCCCTGGCTCGGTAACCGG + Intergenic
1018774398 6:166999600-166999622 CGCCTCCCTGGCGAGGGACCGGG + Intronic
1034522736 7:151632620-151632642 GGGCTCCGCGGCGCGGGGAGGGG + Intronic
1035396538 7:158538731-158538753 CGGCACCACGGGGCGGGAAGAGG + Intronic
1044599709 8:93991553-93991575 CGGCTCCCCGCGGCGGGGGCAGG + Intergenic
1050094233 9:2047273-2047295 CGGCCGCCGGGCGCGGGCACCGG - Exonic
1053550918 9:39078714-39078736 CGGCTCCCCGGCGCGGGAACTGG - Exonic
1053815027 9:41898793-41898815 CGGCTCCCCGGCGCGGGAACTGG - Exonic
1054615569 9:67288648-67288670 CGGCTCCCCGGCGCGGGAACTGG + Intergenic
1057168726 9:92947998-92948020 GGGACCCCCGGCTCGGGAACAGG + Intronic
1061811256 9:133163792-133163814 CGCCACCCCGGCGCGGAAAACGG + Exonic
1198158626 X:133985780-133985802 GGGCACCGCGGCGCGGGGACCGG + Intronic