ID: 1053551629

View in Genome Browser
Species Human (GRCh38)
Location 9:39085823-39085845
Sequence CTTCTCATGGGACATCTAAT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 3, 1: 0, 2: 0, 3: 13, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053551629_1053551632 13 Left 1053551629 9:39085823-39085845 CCTATTAGATGTCCCATGAGAAG 0: 3
1: 0
2: 0
3: 13
4: 192
Right 1053551632 9:39085859-39085881 AAAGTACAATTTTAATGATAAGG 0: 3
1: 1
2: 0
3: 55
4: 511
1053551629_1053551633 22 Left 1053551629 9:39085823-39085845 CCTATTAGATGTCCCATGAGAAG 0: 3
1: 0
2: 0
3: 13
4: 192
Right 1053551633 9:39085868-39085890 TTTTAATGATAAGGAAGCAAAGG 0: 3
1: 0
2: 5
3: 101
4: 963

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053551629 Original CRISPR CTTCTCATGGGACATCTAAT AGG (reversed) Exonic
901742355 1:11350566-11350588 CTTTTTATGGCACATATAATCGG + Intergenic
906903784 1:49866261-49866283 CTTCTCATGGAATATCTTACTGG - Intronic
907057656 1:51386112-51386134 CTTCTCAGAGAACATGTAATGGG - Intronic
911239180 1:95447257-95447279 CTTCTCAGGGGAAATCTTATAGG - Intergenic
911251058 1:95576690-95576712 CCTCTCTTTGGATATCTAATAGG + Intergenic
911504187 1:98728039-98728061 CTTCTCATGGAATATCTTACTGG - Intronic
916224707 1:162477809-162477831 CTTCTCAGGGGAAATCTTACAGG + Intergenic
919031637 1:192250623-192250645 CTTCTCATGGAGTATCTTATTGG + Intergenic
919278950 1:195461530-195461552 CTTCTCATTGTACATCAATTTGG + Intergenic
924883848 1:248190608-248190630 CTTCTCATGGAGTATCTTATTGG - Intergenic
1063902096 10:10744732-10744754 CTTCTAGTGTGACATTTAATTGG + Intergenic
1066518517 10:36190403-36190425 ATTCTCATGGGGCATGAAATGGG + Intergenic
1068369448 10:56094523-56094545 CTTCTCATGGAATATCTTAGTGG + Intergenic
1069360324 10:67633982-67634004 CTTCTCATGGAGCATCTTACTGG - Intronic
1071317281 10:84414637-84414659 CTTCTCTTGGAATATCTTATTGG + Intronic
1072360670 10:94655903-94655925 CTTCTCATGGAGTATCTTATTGG + Intergenic
1077855240 11:6117247-6117269 TTTCTCATGGAATATCTAACTGG - Intergenic
1078627923 11:12975221-12975243 CTTCACATGCTAAATCTAATGGG + Intergenic
1080214870 11:29828712-29828734 CTTCTCATGGAGTATCTTATTGG - Intergenic
1081361109 11:42179525-42179547 CTCCCCAGGGGAAATCTAATGGG + Intergenic
1081720256 11:45283789-45283811 CATCTCAGGGGTCATCCAATGGG - Intronic
1083062651 11:59890767-59890789 CTTCTCATGGAGTATCTTATTGG + Intergenic
1085334998 11:75686618-75686640 CTTCTCATGGAGTATCTAACTGG + Intergenic
1085420660 11:76356025-76356047 CTTCTTATGGGACATCTCCAGGG - Intronic
1086021666 11:82238377-82238399 CTTCTCATGGAGCATCTTACTGG + Intergenic
1086050642 11:82585941-82585963 CTTCTCATTGGAAACCTTATAGG + Intergenic
1089704258 11:120266082-120266104 CCTCTTCTGGGATATCTAATTGG + Intronic
1089732634 11:120528765-120528787 CATCTCATGAGAGATCTCATGGG - Intronic
1094273616 12:28644621-28644643 CTTCTCATGGAGTATCTTATTGG + Intergenic
1098193449 12:67975501-67975523 CTTCTCATGGAATATCTTAGTGG + Intergenic
1098908244 12:76183027-76183049 TTTCTCATGGGAGATTTCATGGG - Intergenic
1101235301 12:102782579-102782601 CTCCTGCTTGGACATCTAATGGG + Intergenic
1103173516 12:118843054-118843076 CTTCTCATAGCACAAGTAATGGG - Intergenic
1108038390 13:46316055-46316077 CTTCTCATGGGATTTCACATCGG + Intergenic
1108173800 13:47771980-47772002 CTTCTCATGGGGTATCTTACTGG + Intergenic
1110104021 13:71647539-71647561 GTTCCCACGGGACATCTAAAAGG + Intronic
1111208626 13:85047049-85047071 CTTCTCCTTGGACATTTACTTGG + Intergenic
1114772050 14:25439013-25439035 ATTCTCAGGGGAAATCTAGTGGG - Intergenic
1115196386 14:30804978-30805000 CTTTTCATGGGTCATCGCATTGG - Intergenic
1115206568 14:30912453-30912475 GTTCTCATCTGACATTTAATGGG - Intronic
1115385380 14:32790374-32790396 CTTCTCATGGAATATCTTACTGG - Intronic
1115679419 14:35719594-35719616 CTTCTCATTAGACAGCTAATGGG + Intronic
1115941329 14:38613717-38613739 ATTCTCATGAGACATTTAGTAGG - Intergenic
1115967966 14:38913234-38913256 CTTCTCATGGGGTATCTTACTGG - Intergenic
1117751218 14:58925392-58925414 CTTCTCATGGAGTATCTTATTGG - Intergenic
1119942661 14:78657484-78657506 TTTCTCATGGCATCTCTAATGGG + Intronic
1123454038 15:20400686-20400708 CTTCTCATGGAGCATCTTACTGG - Intergenic
1123482060 15:20641230-20641252 CTTCTCATGGGGCATCTGCAGGG - Intergenic
1123635955 15:22359138-22359160 CTTCTCATGGGGCATCTGCAGGG + Intergenic
1126967316 15:54069617-54069639 CTTGTCATGGGCCATGTACTTGG + Intronic
1133399837 16:5477565-5477587 GTTGGCATGGGACAACTAATAGG + Intergenic
1135348594 16:21710081-21710103 CTTCTCATGGGCCAAGTATTTGG - Exonic
1135599714 16:23771930-23771952 CTTCTCTTGGGAAATCTGCTGGG + Intergenic
1137655622 16:50155182-50155204 CTTCTGAAGGGAGATCTAGTTGG - Intronic
1141787615 16:86212371-86212393 ATTATCATGGGACATTTACTTGG - Intergenic
1145449757 17:23228809-23228831 ATTCTCATGGAACATCTTTTTGG + Intergenic
1145786726 17:27598430-27598452 CTTCTCCTGGGACTTCTTTTGGG + Intronic
1149174617 17:53854421-53854443 CTTCTCATGGAATATCTTAATGG - Intergenic
1155464777 18:26122096-26122118 CTTCTCATGGAATATCTTACTGG - Intergenic
1156498408 18:37541211-37541233 CCTCTCCTTGGACATCTAACAGG + Intronic
1157139285 18:45089508-45089530 ATTCTCATGGGACACCTACTAGG - Intergenic
1157548857 18:48566732-48566754 CTTCCCATGAGACAACAAATGGG - Intronic
1158524279 18:58198288-58198310 GTTCTCAAGGGAAATCTGATAGG - Intronic
1164187383 19:22882226-22882248 CTTTTCATGGGCTATGTAATTGG + Intergenic
926481247 2:13398542-13398564 CTTCTCATGGAGCATCTTACTGG + Intergenic
927322343 2:21762220-21762242 CTCCTCATGGGACTTCTAACAGG + Intergenic
927625446 2:24712395-24712417 TTTCTCAGGGGACATTGAATGGG + Intronic
927855266 2:26523796-26523818 CTTCTCATGGGGCAGCTGAGTGG - Intronic
933052225 2:77613612-77613634 CTTCTCATGGAATATCTTACTGG - Intergenic
935501070 2:103839714-103839736 CTTCTCTTGTGTCATCTATTTGG - Intergenic
939090115 2:137770368-137770390 CTTCTAATGAGGCATTTAATTGG - Intergenic
940014497 2:149089285-149089307 CTTCTAATGTGAAATCAAATAGG - Intronic
940180268 2:150924030-150924052 CACCTCATGGGACATCTGCTGGG - Intergenic
940994045 2:160127990-160128012 ATGCTTATGGGACATCTAACTGG - Intronic
941670477 2:168287362-168287384 CTTGTAATGGCACAACTAATTGG + Intergenic
941706649 2:168665449-168665471 CGTCCCATGGGAGATCTCATGGG + Intronic
943012721 2:182470733-182470755 CTGTTCATGGGACAGCAAATAGG + Intronic
943286718 2:186010418-186010440 CTTCTCATGGAGTATCTTATTGG - Intergenic
943528167 2:189044681-189044703 CATCTCATGTGTAATCTAATAGG - Intronic
944058606 2:195548226-195548248 CTTCTCCTGGAAGATCTACTTGG - Intergenic
944363836 2:198892950-198892972 CTTCTCATGGAATATCTTACTGG - Intergenic
944965075 2:204922113-204922135 CTTCCCATGGGATATCTAAATGG + Intronic
945439573 2:209863322-209863344 CTTCTCATGGAATATCTTAATGG + Intronic
945565919 2:211399168-211399190 ATTCACATGGGGCATATAATGGG - Intronic
1169757038 20:9053544-9053566 CATCTCATGGGGCATGTAGTTGG - Intergenic
1169980770 20:11381192-11381214 CTTCTCATGGAATATCTTAATGG - Intergenic
1170712048 20:18800042-18800064 CCTCTCATGGCACTTATAATAGG + Intergenic
1172216749 20:33241058-33241080 CTTCACATGTGTCATCTCATTGG + Intronic
1173149550 20:40554412-40554434 CTTCTCATGGAGCATCTTACTGG - Intergenic
1173776891 20:45715986-45716008 CTTCTCATGGGGTATCTTAGTGG - Intergenic
1174973726 20:55306886-55306908 CTTCTCATGGAATATCTTAGTGG - Intergenic
1176969660 21:15250967-15250989 CTTCTCATGTGTCCTCTAATTGG - Intergenic
1183000398 22:34852637-34852659 TTTCACATGAGACATGTAATTGG + Intergenic
1183124101 22:35758793-35758815 CTTCTAATGGTACATCCATTTGG + Intronic
949322637 3:2828276-2828298 CTTCTCAGGTGACATGAAATTGG - Intronic
953115468 3:39988499-39988521 CTTCTCATGGAATATCTTAGTGG + Intronic
955595502 3:60586004-60586026 CTTCTCATGGAGAATCTCATTGG + Intronic
956691262 3:71879722-71879744 CTCTTTATGGGACATCTAAAGGG - Intergenic
957810264 3:85213407-85213429 CTTCTCAATGGAAATCTTATAGG - Intronic
959021346 3:101190818-101190840 GCTCTCATGGGACATGTGATGGG - Intergenic
959452877 3:106524527-106524549 CTTCTCATGGAATATCTTAGTGG - Intergenic
960207967 3:114925936-114925958 GTTCTCATGGGACATTAATTTGG + Intronic
963175131 3:142290074-142290096 CTACTTATGGGATATCTACTAGG - Intergenic
963901268 3:150735614-150735636 CTCCTCATGTGACCTCTAAAAGG + Intergenic
967738010 3:192973913-192973935 CTTCTCAATGGAAATCTTATAGG + Intergenic
968404538 4:328540-328562 CTTCTCATGGAATATCTTAGTGG - Intergenic
968696506 4:2032397-2032419 CTTCTCATGGAGTATCTTATTGG + Intronic
968865100 4:3204298-3204320 CTTCTGCTGTGACATATAATTGG + Intronic
968982502 4:3857955-3857977 CTTTTCATGGGACAGCTCAGGGG + Intergenic
971911980 4:32805798-32805820 CTTCTCTTTGGAAATTTAATGGG + Intergenic
972011432 4:34188214-34188236 CTTCTCATGGAAAAGGTAATAGG - Intergenic
974069916 4:57114101-57114123 CTATTCAGGAGACATCTAATTGG + Intergenic
974200021 4:58624969-58624991 CTTCTCATGGAATATCCTATTGG - Intergenic
974760539 4:66267908-66267930 CTTCTCATGGAATATCTTAATGG - Intergenic
975049648 4:69844455-69844477 TTTCTAATGAGAAATCTAATTGG + Intronic
977053625 4:92162413-92162435 CTTCCCATGGGTGATCCAATAGG - Intergenic
977084287 4:92574810-92574832 CTTCTCATGGAGTATCTTATTGG + Intronic
977414900 4:96720814-96720836 CTTCTCATGGAGTATCTTATTGG + Intergenic
981290512 4:143070095-143070117 CTTCTCATGGAATATCTTAATGG + Intergenic
982528399 4:156507247-156507269 CTTCTCATGGAGCATCTTAGTGG - Intergenic
983344769 4:166513759-166513781 CTTCTCCTCTGACATCTAAAAGG - Intergenic
983774749 4:171593526-171593548 CTTCTCATGGAATATCTTAATGG + Intergenic
984628403 4:182034872-182034894 CTTCTCATGGAATATCTTATTGG + Intergenic
986577441 5:9227374-9227396 CTTCCCGAGCGACATCTAATAGG - Intronic
987542111 5:19269639-19269661 CTACTTATGGGATATCTAGTAGG + Intergenic
993899747 5:93577160-93577182 CTTCTCCTGGGCCCTCTAACTGG + Intergenic
994696451 5:103078534-103078556 CTTCTCATGGAATATCTTAGTGG + Intergenic
995255736 5:110044467-110044489 CTTCTCATGGAGTATCTTATGGG + Intergenic
995685187 5:114765078-114765100 CTTCTCATGGAATATCTTAATGG + Intergenic
995694978 5:114868420-114868442 CTTCTCATGGGGTATCTTACTGG - Intergenic
996181984 5:120430885-120430907 CTTCTCATGGGGTATCTTACTGG + Intergenic
996254894 5:121387431-121387453 CTTCTCATGAAACTTCTAATAGG - Intergenic
996667881 5:126081335-126081357 TTTCTCAGGGGAAATCTTATAGG + Intergenic
997204912 5:132042153-132042175 CTTCTAGTGGGATATCTTATTGG + Intergenic
998040348 5:138947423-138947445 CTTCTCTGGGGACATCTCCTGGG + Exonic
999938789 5:156517494-156517516 CTTCTCATGGAATATCTTACTGG - Intronic
1000277686 5:159753274-159753296 CTTCTAATGGTACATCTGACTGG - Intergenic
1000794909 5:165653218-165653240 ATTCTCATGGGATATCTGATAGG - Intergenic
1005037201 6:21567805-21567827 CTTTTCAGTGGAAATCTAATAGG - Intergenic
1005205673 6:23401632-23401654 CTTCATATGCCACATCTAATTGG - Intergenic
1007251805 6:40500290-40500312 CTTCTCCTGGTACATCCCATGGG - Intronic
1008495679 6:52131575-52131597 CTTGTCATGGGAAATAAAATGGG + Intergenic
1010504989 6:76646059-76646081 CTTCTCATGGGAGAGCCCATAGG - Intergenic
1011544275 6:88467030-88467052 CTCCTCATGGGACTGCTAAGTGG - Intergenic
1013483997 6:110577847-110577869 CTTCTCATGGAATATCTTACTGG - Intergenic
1013854597 6:114556683-114556705 TTTCTCATGGGAGTTCTCATAGG - Intergenic
1016079394 6:139837262-139837284 CTTCTTAAGGGACAGATAATTGG - Intergenic
1016847796 6:148586389-148586411 CTTCTCATGGAGCATCTTACTGG + Intergenic
1017343029 6:153348234-153348256 CTTTTCATGGGTCATTTAAGGGG - Intergenic
1018023986 6:159789752-159789774 CTTCCCATCGGCTATCTAATTGG - Intergenic
1018565226 6:165144588-165144610 CTTCTCCTGGGAAATCTAAGGGG + Intergenic
1021358232 7:19680927-19680949 ATTATCATGTGACATCAAATAGG + Intergenic
1022737504 7:33089794-33089816 GTCCCCATGGGACATCTAAGTGG + Intergenic
1022984011 7:35632453-35632475 CTTCTCATGATACATTAAATTGG + Intergenic
1030256693 7:107517498-107517520 CTTCTCATGGAATATCTTAGTGG - Intronic
1030628514 7:111870132-111870154 CTTCTCATGGGTCAGAAAATTGG - Intronic
1030759458 7:113332315-113332337 CTTCTCATGGAGCATCTTAGTGG - Intergenic
1030891166 7:115001332-115001354 CTTCTCTTGGGAAATCAAACTGG + Intronic
1031311755 7:120207442-120207464 CTTCTCATGGAATATCTTAATGG - Intergenic
1033791727 7:144798431-144798453 CTTCTCATGGAGTATCTTATTGG - Intronic
1034163601 7:149009763-149009785 CTTTGCATGTGACATCTCATTGG - Intronic
1034295928 7:149972491-149972513 CTTGTCATGGGACATGTAAGAGG - Intergenic
1034308032 7:150061989-150062011 CTTCTTAGGGAACATATAATGGG - Intergenic
1034798821 7:154038682-154038704 CTTCTTAGGGAACATATAATGGG + Intronic
1034810123 7:154124411-154124433 CTTGTCATGGGACATGTAAGAGG + Intronic
1035491859 7:159286176-159286198 CTTCTCATGGAATATCTTAGTGG - Intergenic
1035599320 8:887861-887883 CTTCTCATGGAGCATCTTAATGG + Intergenic
1036219163 8:6906450-6906472 ATTCTCATGGCACATCTGAGAGG + Intergenic
1038073855 8:24047672-24047694 CTTCTCATGGAGCATCTTAGTGG - Intergenic
1040372037 8:46786765-46786787 CTTCTCATGGGTTATCTTACTGG + Intergenic
1040404255 8:47084932-47084954 CTTCTCATGGCATATCTTACTGG + Intergenic
1042489697 8:69382812-69382834 CTTCTCATGGAGTATCTTATTGG - Intergenic
1042758520 8:72245163-72245185 ATTCTCATGAAACATTTAATGGG + Intergenic
1044158499 8:88881622-88881644 CTTCACATGGGACTTTTTATAGG - Intergenic
1046319271 8:112550084-112550106 CTTCTCATGGCACTGCTAAGTGG - Intronic
1046416171 8:113916441-113916463 CTTCTCATGGAATATCTTACTGG + Intergenic
1047029441 8:120861192-120861214 TGTCTCATGGGACATCTCAAGGG - Intergenic
1048060994 8:130919084-130919106 TCTCTCATGGAACACCTAATGGG - Intronic
1048220518 8:132536974-132536996 CTTCCCATGAGTCATCTGATGGG - Intergenic
1050914139 9:11109721-11109743 CTTTTCAAGGGAAATCTTATAGG + Intergenic
1052225118 9:26076619-26076641 CTTCTCATGGAGCATCTTAATGG + Intergenic
1053508163 9:38663693-38663715 CTCCTTATGTGACATCTAGTAGG - Intergenic
1053551629 9:39085823-39085845 CTTCTCATGGGACATCTAATAGG - Exonic
1053815751 9:41905955-41905977 CTTCTCATGGGACATCTAATAGG - Exonic
1054614845 9:67281486-67281508 CTTCTCATGGGACATCTAATAGG + Intergenic
1054733473 9:68725970-68725992 CTTCTCATATTACATCTAAATGG - Intronic
1057581248 9:96289666-96289688 CTTCACATGGAACCTCTAAAAGG - Intronic
1057585846 9:96327938-96327960 CCTCTCTGGGGACATCTAGTGGG - Intronic
1058514273 9:105753318-105753340 CTTCTCATGGAGTATCTAACTGG - Intronic
1059262536 9:112992567-112992589 CTTCTCATGGAATATCTTACTGG + Intergenic
1059318956 9:113451313-113451335 CTTCTCCAGGGAAATCTGATTGG - Intronic
1059792916 9:117660052-117660074 AGTCTCCTGGGAAATCTAATAGG + Intergenic
1059870410 9:118567468-118567490 CTTCTAATGGAACATCCATTTGG - Intergenic
1189134180 X:38532148-38532170 CTTCTCCTCAGACTTCTAATTGG + Intronic
1189561935 X:42200093-42200115 CTTCTCATTGGGAATCTCATAGG + Intergenic
1191185381 X:57606233-57606255 CTTCTCATGGAGTATCTTATTGG + Intergenic
1192735087 X:73843148-73843170 CTTCTCCTGGGACTGTTAATAGG - Intergenic
1192841487 X:74861499-74861521 CTTCTCATGGAGTATCTTATTGG - Intronic
1193533478 X:82685315-82685337 CTTCTCATGGAATATCTTACTGG + Intergenic
1194183259 X:90738908-90738930 CTTCTCATGGAGTATCTTATTGG - Intergenic
1195812830 X:108852838-108852860 CTTCTCATGGAGTATCTTATTGG - Intergenic
1197114887 X:122819790-122819812 CTTCTCATGGAATATCTTACTGG - Intergenic
1197686862 X:129449388-129449410 CTTCTCACCGGACATCTTGTGGG + Intronic
1199941697 X:152633910-152633932 CATCTCATGGGCCATCAAAGAGG - Intergenic
1200372494 X:155741505-155741527 CTTCTCATGGAGCATCTTACTGG - Intergenic
1200529875 Y:4320863-4320885 CTTCTCATGGAATATCTTATTGG - Intergenic
1201614504 Y:15882314-15882336 CTTCTCATGGAACATGAGATAGG - Intergenic
1201615864 Y:15897461-15897483 CTTCTCATGGAACATGAGATAGG + Intergenic