ID: 1053553436

View in Genome Browser
Species Human (GRCh38)
Location 9:39108273-39108295
Sequence CTCACTCCCCAGAGAGGGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 375
Summary {0: 1, 1: 3, 2: 1, 3: 35, 4: 335}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053553436 Original CRISPR CTCACTCCCCAGAGAGGGGG GGG (reversed) Intronic
901064562 1:6488756-6488778 CTCCCTCCCCAGGGAGTTGGGGG - Intronic
901091732 1:6646130-6646152 CTCTATCCACACAGAGGGGGAGG + Intronic
901100609 1:6715853-6715875 CTCACTTCCCAGACGGGGTGGGG + Intergenic
901203083 1:7477685-7477707 CCCAGTCCCCAGAGGCGGGGAGG - Intronic
901921691 1:12541559-12541581 CTCTGTCCCCAGAGCTGGGGAGG + Intergenic
902960529 1:19960011-19960033 CTCCTTCCCCAGGGAAGGGGTGG + Intergenic
903779188 1:25810714-25810736 CTCCCTCCCCAGAGTGGGAAGGG + Intronic
904360850 1:29970939-29970961 CCCACTCCAGAGAGAGGGCGAGG - Intergenic
905028602 1:34866979-34867001 TCCCCTCCCCAGAGAGGTGGAGG - Intronic
905360321 1:37414806-37414828 CTCACACTCCAGAGAAGGTGGGG + Intergenic
905974763 1:42166098-42166120 CACACTCACCAGAAAGGGGTGGG - Intergenic
906154423 1:43605753-43605775 CCCTCTCTCCAGAGAGGGGCGGG - Intronic
906207852 1:43996667-43996689 CTCCCACTCCAGAGAGGGGAGGG + Intronic
907402362 1:54232996-54233018 CTCACTTCCCAGACGGGTGGCGG - Intronic
907427000 1:54386225-54386247 CTCGCTCCCCACAGAAGGAGGGG + Intronic
907517006 1:54999139-54999161 CACACCCCCGGGAGAGGGGGTGG - Exonic
908234694 1:62138003-62138025 CTCCCAACCCAAAGAGGGGGAGG - Intronic
909623070 1:77687422-77687444 CTCACTTCCTAGAGGGGGTGGGG - Intergenic
909623083 1:77687462-77687484 CTCACTTCCCAGACAATGGGGGG - Intergenic
909623105 1:77687542-77687564 CTCACTTCCCAGATGGGGTGGGG - Intergenic
910262559 1:85306328-85306350 CTGTCTCCCCAGAGATGGGGCGG - Intergenic
910891746 1:92026465-92026487 CTCACTTCCCAGATGGGGTGGGG + Intergenic
911461966 1:98202741-98202763 CTCACATGGCAGAGAGGGGGGGG - Intergenic
911569065 1:99500527-99500549 CTAACTCCCCAGAGAATGGCAGG + Intergenic
913528284 1:119713839-119713861 CTGATACCCCAGTGAGGGGGTGG + Intronic
914947395 1:152079345-152079367 GTCACTTCCCAGACAGGGCGGGG + Intergenic
915221682 1:154379852-154379874 CTCACTTCCCAGACAGTTGGCGG + Intergenic
915221699 1:154379931-154379953 CTCACTTCCCAGACAGTTGGCGG + Intergenic
915221716 1:154380010-154380032 CTCACTTCCCAGACAGTTGGCGG + Intergenic
916713904 1:167434469-167434491 CTCCCTCCCCACAGGAGGGGCGG + Intronic
919845423 1:201639410-201639432 CCCACTCCCCAAGGAGGGGAAGG + Intronic
921007671 1:211111342-211111364 CTCACTTCCCAGACGGTGGGGGG - Intronic
921007729 1:211111549-211111571 CTCACTTCCCAGACGGGGCGGGG - Intronic
921007751 1:211111628-211111650 CTCACTTCCCAGACGGGGCGGGG - Intronic
921007781 1:211111721-211111743 CTCACTTCCCAGACTGGGGTTGG - Intronic
922469761 1:225868826-225868848 CTGTGTCCCCAGAGATGGGGAGG + Intronic
922718960 1:227890671-227890693 CTCGCACCCCAGCCAGGGGGAGG + Intergenic
922730582 1:227947056-227947078 CCCAGACCTCAGAGAGGGGGAGG + Intronic
1065122218 10:22541281-22541303 TTCACACCCCTGAGAGGGAGAGG + Intronic
1066026156 10:31362268-31362290 CTCAATTCCCAGATAGTGGGCGG + Intronic
1066026177 10:31362347-31362369 CTCACTTCCCAGAGTGTAGGGGG + Intronic
1066432182 10:35362804-35362826 CTCACTCCCCAGATAGTTGGCGG + Intronic
1067528953 10:47056394-47056416 CTCTCTCTCCAGGGAGGAGGTGG - Intergenic
1070371019 10:75781981-75782003 CACATTCCCCACAGAGGGAGAGG - Intronic
1070810333 10:79294413-79294435 CTCACTTCCCAGAGGGCAGGAGG - Intronic
1071341770 10:84655633-84655655 CTCACTTCCCAGACAGGGCAGGG + Intergenic
1071418119 10:85459961-85459983 CTCTCTCCCGAGAGAGAGAGGGG - Intergenic
1072740140 10:97904276-97904298 CTCAGGGCCCAGAGTGGGGGTGG - Intronic
1073572105 10:104589365-104589387 CTCCTTCCTCAGTGAGGGGGAGG + Intergenic
1075009748 10:118857553-118857575 CTCCCTCCCCAGGGAAGGGCAGG + Intergenic
1075791013 10:125084510-125084532 CTCCCTTCCCAGAGAGGATGGGG - Intronic
1076469208 10:130706964-130706986 CTCTCTGCCCACAGAGGGGCTGG + Intergenic
1076808049 10:132869154-132869176 CTCACTCTCCCCAGAGGGGCAGG + Intronic
1077017549 11:403604-403626 CTCCCTCCCCACAGTGGGCGGGG + Exonic
1077058851 11:609022-609044 CCCATTCCCCAGAGAGGAAGGGG + Exonic
1077131646 11:975943-975965 CACACTCCTCAGAGAGGAGGAGG - Intronic
1077391127 11:2301092-2301114 CTCCCTCCGCAGAGGGAGGGAGG + Intronic
1077583798 11:3435199-3435221 CTCACTGCCCAGGGACGGCGGGG + Intergenic
1077630634 11:3808835-3808857 CTCCCTCCCCAGCGTGGGGCCGG + Intronic
1078337314 11:10474476-10474498 CTGATTCCCCAGAGCGGAGGAGG + Intronic
1079427849 11:20360670-20360692 CTCACTCCCCAGAGGTGTGCCGG + Intergenic
1081997032 11:47372410-47372432 CTCACTCTCCAGCGAGGGGATGG - Intronic
1082065083 11:47893016-47893038 CTCACTTCTCAGACGGGGGGGGG - Intergenic
1082833092 11:57633927-57633949 CTGACTCTCCTGAGAAGGGGTGG + Intergenic
1083299653 11:61733742-61733764 CTCACTGCCCAGCGAGGAGGCGG + Intronic
1083332697 11:61906330-61906352 CTCACATCCCAGAGAGGCGCAGG + Intronic
1083587236 11:63869219-63869241 CTCCCTGCCCAGGGTGGGGGTGG - Intronic
1083894638 11:65613882-65613904 CTGGCTCCCCAGAGAGGCGTGGG - Exonic
1084607561 11:70181309-70181331 CTCAGTCCCCACAGAGGGCAGGG + Intronic
1085037294 11:73308206-73308228 CTCGCGCCCAAAAGAGGGGGTGG - Intergenic
1085122138 11:73974095-73974117 CTGACTCCACAGAGGGTGGGTGG - Intergenic
1088677206 11:112206143-112206165 CTCACTTCCCAGACAGGGCGGGG + Intronic
1088677239 11:112206263-112206285 CTCACTTGCCAGAGGGTGGGCGG + Intronic
1088693022 11:112344009-112344031 CCCACTGCCCAGAGAGGCTGAGG + Intergenic
1088829613 11:113524111-113524133 CTCACTTCCCAGACGGTGGGCGG - Intergenic
1089329421 11:117679344-117679366 CTTCCTCCCCAGAGAGGGTCAGG + Intronic
1090383415 11:126342761-126342783 CTCACTCCCCAGAGCTGTCGGGG - Intronic
1090669997 11:128939348-128939370 CTCACTCCCCGCAGAGGCAGGGG + Intronic
1090845273 11:130524996-130525018 CTCACTGCCCAGAGAGGACACGG + Intergenic
1091038367 11:132254229-132254251 GACACTCCCCAGGGAGGGGCAGG - Intronic
1091631945 12:2168706-2168728 TTCAGTCCTCAGAGAGGTGGAGG + Intronic
1091647984 12:2288252-2288274 CTCACTCCTCAGAGAGAAGCTGG - Intronic
1092002493 12:5044023-5044045 AGCTCTCCCCAGAGAGGGGCCGG + Exonic
1093548002 12:20369842-20369864 CTCACTCCCCGCCGCGGGGGTGG + Exonic
1094087341 12:26608405-26608427 CTCACTTCCCAGACGGTGGGGGG - Intronic
1094319809 12:29172042-29172064 CTCACTTCCCAGACAGTTGGTGG - Intronic
1094319817 12:29172081-29172103 CTCACTTCCCAGACAGTTGGTGG - Intronic
1095452742 12:42349998-42350020 CTCCCACCCCCCAGAGGGGGTGG + Intronic
1095561977 12:43576020-43576042 CTCACTCCCTACAGAGTGGGAGG - Intergenic
1095738794 12:45585969-45585991 CTCACTTCCCAGACTGTGGGTGG + Intergenic
1096389691 12:51218446-51218468 CTCCCTCCCTAGAAAGGCGGGGG + Intergenic
1096634297 12:52948921-52948943 CTCACCCCCCAGAAACGGGGTGG - Intronic
1097254908 12:57665652-57665674 CTCACTTCCCAGACAATGGGTGG - Intergenic
1097264129 12:57736236-57736258 CACACTCCCGGGAGAGGAGGCGG - Intronic
1098375152 12:69807183-69807205 CTCACATCCCAGACAGTGGGCGG + Intronic
1100464020 12:94829185-94829207 CTCATACCCCAGAGATGGGAAGG + Intergenic
1102008908 12:109606309-109606331 CTCACTCCCCAGAGCCAGAGGGG - Intergenic
1102198070 12:111038444-111038466 CTCAGCCCCCTGAGAGGGGTTGG + Intronic
1103927994 12:124434225-124434247 CTGACTCCCCAGTGGGGGTGAGG + Intronic
1104303960 12:127592633-127592655 CTCTCTCCCCTGAGAGAGAGGGG + Intergenic
1104758708 12:131284353-131284375 CTCCCTTCCCAGGGAGGGGAGGG + Intergenic
1104821892 12:131682172-131682194 CTCCCTTCCCAGGGAGGGGAGGG - Intergenic
1104835317 12:131786492-131786514 CCCACTCCCCTGAGAGACGGAGG + Exonic
1106601598 13:31192221-31192243 CACACTCCACAGAGTGGGAGTGG - Intergenic
1107793645 13:44028367-44028389 CTCTTTCCCAAGAGAGGGAGAGG - Intergenic
1110626592 13:77661164-77661186 GTCACTTCCCAGATAGGGTGGGG + Intergenic
1111572708 13:90107876-90107898 CTCACCCGCCAGCAAGGGGGTGG + Intergenic
1113138128 13:107116748-107116770 CTCCCACCCCAGAGAAGGGTAGG - Intergenic
1113331801 13:109334523-109334545 CTCCCTCTCCAGAGAGGGGCAGG - Intergenic
1114255753 14:21000181-21000203 CTCACTCTCCAGATAGGGGATGG - Intronic
1118148847 14:63166219-63166241 CTCACCTCCCGGAGACGGGGCGG - Intergenic
1119419674 14:74501084-74501106 CTTACTAACCAGAGAGGTGGAGG - Intronic
1119982636 14:79099300-79099322 CTCACTGCACAGAGAGGGAGAGG + Intronic
1120416667 14:84227876-84227898 CTCACATGCCAGAGAGGGAGAGG + Intergenic
1121412571 14:93758020-93758042 CTCACTCCAGAGATACGGGGGGG + Intronic
1121617033 14:95320045-95320067 CTCACTCCCCCGTGCGGGGGCGG + Intergenic
1121659598 14:95624865-95624887 CTGGCTCCCCAGAGACAGGGTGG + Intergenic
1121694435 14:95901350-95901372 CTTCCTCCCCAGAGAGTTGGGGG + Intergenic
1122367124 14:101200834-101200856 CTCACTCACCAAAGAGGGGATGG - Intergenic
1122401444 14:101469741-101469763 GACACTTGCCAGAGAGGGGGTGG + Intergenic
1122760436 14:104020906-104020928 CTCATGCCCCAGAGTGGGGCTGG + Intronic
1124100344 15:26687068-26687090 CTCACTTCCCAGAGTGGCAGGGG - Intronic
1125003731 15:34795851-34795873 CCCACACCCCAGAAAGGGGGAGG - Exonic
1126890291 15:53197624-53197646 GTCCCTCCTCAGACAGGGGGCGG - Intergenic
1127088565 15:55446283-55446305 CTCACATCCCAGACGGGGGGGGG + Intronic
1127569798 15:60230849-60230871 ATCACTCTTCAGAGAGGGCGTGG + Intergenic
1132115253 15:99131267-99131289 CGCCCTCACCAGAGAGGGGCAGG + Exonic
1132221522 15:100108918-100108940 CACTCTCCCCAGACAGGGAGTGG - Intronic
1132350834 15:101138880-101138902 CTGACTCCCCAAAGAGGGGCTGG + Intergenic
1132564990 16:617971-617993 CTCACTCCCCAGGTGGGCGGGGG + Intronic
1133071353 16:3248780-3248802 CTCTGTCCCCTGAGAGGAGGTGG + Intronic
1133103096 16:3491021-3491043 CTCATTCCCCAGAGACGCAGAGG - Intergenic
1134750089 16:16618949-16618971 CTCACTTCCCAGACGGGGCGGGG + Intergenic
1134846667 16:17446593-17446615 CTCACTCCCAAGACTGGGAGGGG - Intronic
1134854764 16:17509086-17509108 TACACTCCACAGAGTGGGGGTGG - Intergenic
1135432386 16:22396615-22396637 TACACTCCCCAGAGAGGCAGAGG + Intronic
1136514421 16:30759331-30759353 TTCACACCCCAGGTAGGGGGTGG - Exonic
1138037681 16:53625219-53625241 CTCACTTCCCAGACAATGGGTGG - Intronic
1138281067 16:55772640-55772662 CTCACTGCCCAATCAGGGGGTGG + Intergenic
1138898611 16:61241055-61241077 CTCACTCCTCTGAGAGTGAGGGG - Intergenic
1139201717 16:64984212-64984234 TTCCCTCCCCAGCGAGGTGGGGG + Intronic
1139340183 16:66263371-66263393 CTCAGCCTCCAGAGATGGGGGGG + Intergenic
1140300905 16:73756544-73756566 CTCCCTCCCCAGTGAAGGGCGGG - Intergenic
1144877052 17:18403636-18403658 CTCTGTCCCCAGAGAGGTGATGG + Intergenic
1145155178 17:20540772-20540794 CTCTGTCCCCAGAGAGGTGATGG - Intergenic
1146943652 17:36860121-36860143 CCCGCTCCCCAGAGATGGAGTGG - Intergenic
1147137266 17:38441531-38441553 CTGAGGCCCCAGAGAGGGCGGGG + Intronic
1147187070 17:38718771-38718793 CTGACTCTCCAGGGAGAGGGCGG - Intronic
1147220416 17:38925548-38925570 CTCAGGCCCCTGGGAGGGGGAGG + Intergenic
1148207326 17:45787271-45787293 CTCTATCCCCAGGGAGGGGCAGG + Intronic
1148339963 17:46867529-46867551 CCCACTCTCCAGGCAGGGGGTGG + Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1151096941 17:71509340-71509362 GTCACTCCCCAAGGAGGGTGAGG - Intergenic
1151585343 17:75005089-75005111 CCCAGTCCCCAGTGAAGGGGAGG - Exonic
1151756464 17:76077954-76077976 TTCACTCCCCGGCGGGGGGGGGG + Intronic
1152078593 17:78172982-78173004 CTCCCTTCCTAGAGTGGGGGTGG + Exonic
1152103999 17:78318456-78318478 CACACTCCCCAGAATTGGGGTGG - Intergenic
1152461585 17:80444852-80444874 CTCACTCCCCCGAATGGGGGTGG - Intergenic
1153514271 18:5890585-5890607 CGCACTCCCCGGGGAGGGCGGGG + Exonic
1153964348 18:10166556-10166578 CTCATTGCCCTGAGAGGGGCAGG + Intergenic
1155229475 18:23758552-23758574 CTCAGCCCCCAGGGAGAGGGGGG - Intronic
1156345899 18:36256989-36257011 CTCATTCACCAGAGAAAGGGTGG - Exonic
1157595653 18:48862184-48862206 CTCATGCCACAGAGAGGGGATGG - Intronic
1160503871 18:79416724-79416746 TTCCCTCCCCAGAAAGGGAGGGG - Intronic
1160895949 19:1401821-1401843 CTCACACCCCAGCGAGGAGGGGG - Intergenic
1161212598 19:3075368-3075390 CTCCCTCCCCACTGAGGGTGTGG + Intergenic
1161264897 19:3359617-3359639 CTCGGTCCCCGGCGAGGGGGGGG - Intronic
1161593046 19:5137343-5137365 CTCGCTCCCCGCAGCGGGGGTGG + Intronic
1162913980 19:13864884-13864906 CACACACCCAAGGGAGGGGGTGG - Intronic
1162974928 19:14203194-14203216 CTGCCTCCCCACAGAGGGGCTGG + Intronic
1163712435 19:18854772-18854794 CCCACTCCACAGTGACGGGGAGG - Intronic
1164017470 19:21265285-21265307 CTCCCTTCCCAGACAGGGCGGGG - Intronic
1164155769 19:22596082-22596104 CCCTCTCCCCAGAGTGGGCGGGG + Intergenic
1166267269 19:41691984-41692006 CGAACTCCCCAGAGAGAGAGAGG - Intronic
1166340133 19:42132454-42132476 CTCGGCCCCCAGAGAGGGTGGGG - Intronic
1166706557 19:44911206-44911228 CTCAGTTCTCAGAGACGGGGAGG + Intergenic
1166823614 19:45595924-45595946 ACCAATCCCCAGAGAGGGGACGG + Intronic
1167300386 19:48674288-48674310 CTCAGTGTCCAGAGAGGGAGGGG + Intergenic
1167830949 19:52022337-52022359 CTCACTTCCCAGATGGTGGGCGG - Intronic
1167971146 19:53188162-53188184 CTCACTTCCCAGACGGGGTGGGG + Intronic
1168121480 19:54254582-54254604 CTCACCCCTCAGAGGGGAGGAGG - Intronic
1168266839 19:55228025-55228047 CTCACGCTCCAGCGAGGGGTGGG - Intronic
928720899 2:34119667-34119689 CACACACCCCAGAGAAGGGAAGG + Intergenic
929572565 2:43031904-43031926 CTCACTCCCCATGGGGAGGGTGG + Intergenic
931242193 2:60463080-60463102 CTCACACCCCAGACTGTGGGAGG + Intronic
932063074 2:68527682-68527704 CTCACTGCCCAGACAGGGCAGGG + Intronic
932063094 2:68527762-68527784 GTCACTTCCCAGAGAGGGCGGGG + Intronic
932063152 2:68528002-68528024 GTCACTTCCCAGAGAGGGCGGGG + Intronic
933869237 2:86549918-86549940 CTCACTTCCCAGACAATGGGCGG + Intronic
937316569 2:120935476-120935498 CCCACAGCCCAGAGATGGGGAGG - Intronic
937876645 2:126831000-126831022 CTGACTCCACAGAGAGGAAGTGG + Intergenic
938083112 2:128380737-128380759 CACACACCCCAAGGAGGGGGCGG - Intergenic
941745263 2:169080360-169080382 CTCCCTCCCCACAGAGGAGCAGG - Intronic
942276787 2:174328846-174328868 GTCTGTCCCCAGAGAGGGGGAGG - Intergenic
945199501 2:207267052-207267074 CTCACTCCCCAAAGTGGGAGTGG + Intergenic
945818858 2:214638506-214638528 CCCCCTCCCCAGGGAGTGGGGGG - Intergenic
946249716 2:218404911-218404933 CTCAGTCCCAAGGGAGGAGGTGG - Exonic
946409532 2:219509222-219509244 CCTGCTTCCCAGAGAGGGGGAGG - Intergenic
947753637 2:232545529-232545551 CTCATTCCCCTGAGGGTGGGAGG - Exonic
948697839 2:239742310-239742332 CTCAGTGCCAAGAAAGGGGGTGG - Intergenic
1169140966 20:3227364-3227386 TCCCCTCCCCAGAGTGGGGGTGG + Intergenic
1170148229 20:13200789-13200811 CTGCCTTCCCAGTGAGGGGGAGG + Intergenic
1170599733 20:17832014-17832036 CACACTCCCCAGAGATTGGAAGG + Intergenic
1171403220 20:24892691-24892713 CTCAGGCCCCAGGGAGTGGGAGG - Intergenic
1172436337 20:34931338-34931360 CTAAAGCCCCAGAGAGAGGGTGG - Exonic
1173809113 20:45945697-45945719 CTCCCTGCCCACAGAGGAGGTGG + Exonic
1173868535 20:46328227-46328249 CTCACTCCCTGGTGAGGGAGGGG - Intergenic
1176252972 20:64134367-64134389 CCCACTCCCCAGAAAGGATGAGG - Intergenic
1176389639 21:6156931-6156953 CCCAGTCCCCAGAGAGGAAGTGG + Intergenic
1177782740 21:25638443-25638465 CTTAGTACCCAGGGAGGGGGTGG - Intergenic
1177788296 21:25695653-25695675 CTCACTTCCCAGACGGGGCGGGG + Intronic
1178683159 21:34690181-34690203 CTCACAGCTCAGAGAGGGTGAGG + Intronic
1179615973 21:42583712-42583734 GTCACTTCCCAGGGTGGGGGGGG + Intergenic
1179629637 21:42668383-42668405 GTGAGGCCCCAGAGAGGGGGTGG + Intronic
1179733829 21:43381307-43381329 CCCAGTCCCCAGAGAGGAAGTGG - Intergenic
1180183576 21:46128763-46128785 CTCACATCCCAGAGAGGCTGAGG + Intronic
1181658109 22:24318101-24318123 CTCACTTCCCAGACGGGGTGGGG + Intronic
1182446134 22:30390620-30390642 CAAACTCCCAAGAGAGGGTGGGG + Intronic
1183116082 22:35693764-35693786 ATTACTCCCCATATAGGGGGCGG + Intergenic
1183350027 22:37329862-37329884 CCCAGGCCCCAGTGAGGGGGAGG + Intergenic
1183497146 22:38153340-38153362 CTCACTTCCCAGACAGGGCGGGG - Intronic
1183945439 22:41323280-41323302 CTCACTCCCCAAAATGGGAGAGG - Intronic
1183966137 22:41444129-41444151 CTCACTCCCCGGACAGCGGCAGG - Intronic
1184759100 22:46534946-46534968 CTCAGCAGCCAGAGAGGGGGCGG - Exonic
1185283736 22:49989940-49989962 CTCACTTCCCAGACGGGCGGTGG + Intergenic
950110680 3:10416932-10416954 CTCACTTCCCAGATGGTGGGTGG + Intronic
950110774 3:10417253-10417275 CTCACTTCCCAGAGAGTGTGGGG + Intronic
950110782 3:10417293-10417315 CTCACTTCCCAGACAGTGGCAGG + Intronic
950785828 3:15434670-15434692 CTCACTGTTCAGAGATGGGGAGG + Intronic
952213248 3:31250584-31250606 TTCACTCCCCAGTGATGTGGGGG - Intergenic
952513020 3:34076186-34076208 CTCACTTCCCATACAGTGGGTGG + Intergenic
953209736 3:40865080-40865102 TTCACTCTGCAGAGAGGGGAAGG + Intergenic
953389240 3:42525125-42525147 TCCTCTCCCCAGAGAGGGAGAGG - Intronic
955687787 3:61562945-61562967 CCCAGCCCCCAGAGAGAGGGAGG - Intronic
956072310 3:65466582-65466604 CTGACTCCACAGGGAGAGGGTGG + Intronic
956792099 3:72687943-72687965 ATCACTACCCTGAGAGGGCGGGG - Intergenic
957193484 3:77039675-77039697 CCCACTCCCCAGCGGGCGGGTGG + Intronic
957283062 3:78178940-78178962 CTCACTCCCCACAGATAGGCAGG - Intergenic
958406001 3:93760376-93760398 CTCACTTCCCAGACGGTGGGTGG + Intergenic
960054560 3:113267968-113267990 CTTACACCCCAGAAATGGGGGGG - Intronic
960379142 3:116938890-116938912 GTAAATCCCCAGAGATGGGGAGG + Intronic
961162919 3:124744896-124744918 CTCACTCTCCAAAGAGGGGAAGG + Exonic
962840394 3:139227308-139227330 CTGACTCTGCAGAGTGGGGGTGG + Intronic
964060675 3:152518432-152518454 GCCACTACCCAGAGAGGTGGAGG - Intergenic
964760788 3:160133439-160133461 CTGAGTCCCCATAGAGGGGATGG + Intergenic
968602527 4:1517079-1517101 CTCCCTCCCCTGAGGAGGGGTGG - Intergenic
969283881 4:6190531-6190553 CTCACTCCCCAGCAATGAGGTGG + Intronic
970555804 4:17231354-17231376 CTCACTCCCCCCAGGGAGGGAGG + Intergenic
970580679 4:17471570-17471592 TTCACTCCCCAGAGAGGGGCAGG - Intronic
971593275 4:28496587-28496609 CTCACTCACCACAGAGAGTGAGG + Intergenic
971756670 4:30717252-30717274 GTCAGCCCCTAGAGAGGGGGCGG + Intergenic
977115273 4:93016544-93016566 CCAACTGCCCAGAGAGGGGATGG - Intronic
977536505 4:98261185-98261207 CTCGCTCGCCACAGAGGGAGGGG + Intergenic
979273658 4:118791979-118792001 CTCACTTCCCAGACAATGGGCGG - Intronic
979846929 4:125525283-125525305 TTCACTTCCCAGAGAGGTAGGGG - Intergenic
982157471 4:152536079-152536101 CTCACTCCAGAGAGAGGGGCGGG + Exonic
982394229 4:154898479-154898501 CTTATTCCCCAGAGAGATGGGGG + Intergenic
982766133 4:159351116-159351138 CTCACTTCCAAGAGAAGAGGAGG - Intronic
983628687 4:169828218-169828240 CTCACTTCCCAGACGGGTGGCGG - Intergenic
983876569 4:172883547-172883569 CTCACTCACCAGCAAGGGGATGG + Intronic
985997818 5:3606501-3606523 CTCACTGCCCAGAAAGGGCCAGG - Intergenic
986015643 5:3754746-3754768 CCTTCTCCCCAGAGAGGAGGTGG + Intergenic
986040612 5:3990553-3990575 CTGACTGCCCAGGGAAGGGGTGG + Intergenic
990240900 5:53815767-53815789 TTCACTCACCTGAGATGGGGTGG - Intergenic
991267586 5:64740166-64740188 CTCTCTCCCTAGAGAGAGAGTGG - Intronic
991972830 5:72157542-72157564 GTCAGTCCCCAGGGAGGGTGGGG - Intronic
992024184 5:72654333-72654355 CTCTCTCCCCACAGAGGGAGGGG + Intergenic
993900722 5:93582744-93582766 CTCACACCCCAGAGGGGGAAGGG - Intergenic
994261617 5:97665875-97665897 CTCAATACACAGAGAGGGGCTGG - Intergenic
995037057 5:107546059-107546081 TTCACTGCCCAGAGAGATGGGGG + Intronic
995421078 5:111967632-111967654 CTCACTTCCCAGACAGGGCGGGG - Intronic
996159858 5:120148029-120148051 CTCACATCCCAGAAAGGCGGCGG - Intergenic
996310805 5:122102320-122102342 ATCAAACCCCAGAGAAGGGGTGG + Intergenic
998005936 5:138657080-138657102 CCCACTCTCCAGGGAGGAGGAGG + Intronic
998077204 5:139246490-139246512 CTCATTCCCAAGACTGGGGGTGG + Intronic
999177326 5:149640537-149640559 CACACTCCCCAGGGATGTGGGGG + Intergenic
999397937 5:151242369-151242391 CTCACTCCACAGGGTGGGAGGGG + Intronic
1002073252 5:176693144-176693166 GCCACTCCCCAGAGTGGGGAAGG - Intergenic
1002635090 5:180603324-180603346 CTGACTCCCAAGGGAGGCGGCGG - Exonic
1003397107 6:5762971-5762993 CGCACTCCCCAGAGGAGGAGAGG - Intronic
1004262991 6:14124517-14124539 CTCATTCCCCAAGGAGTGGGAGG + Intronic
1004631424 6:17425408-17425430 TTCACTCCCCAGGGGGTGGGGGG - Intronic
1005243389 6:23855650-23855672 GTCACTTCCCAGACAGGGCGGGG - Intergenic
1005345413 6:24884585-24884607 CTCACTCCTCAGCAAGGGGATGG + Intronic
1005583051 6:27251452-27251474 GGCGCTCCCCAGAGAGGGCGGGG + Intronic
1006443043 6:34063827-34063849 CTGTCTCCCCAGATGGGGGGAGG - Intronic
1007687844 6:43677585-43677607 CCTCCTCCCCAGAGATGGGGAGG - Intronic
1009398436 6:63228795-63228817 GTCACTTCCCAGACAGGGTGGGG + Intergenic
1013614758 6:111831888-111831910 ATCACACCCTAGAGAGAGGGAGG + Intronic
1017726028 6:157276427-157276449 TCCACTCCCCAGGGAGGGAGGGG + Intergenic
1017856023 6:158350190-158350212 CTCACTTCCTAGACAGGGTGGGG + Intronic
1018848575 6:167572079-167572101 CTGACACCCCAGAGTGGGGATGG + Intergenic
1020051579 7:5085484-5085506 CTCACACCTCAGGGAGGGAGTGG + Intergenic
1021351659 7:19601873-19601895 CACACCCCCAAGGGAGGGGGTGG - Intergenic
1021493505 7:21246609-21246631 CTCACTTCCCAGATGGGGTGGGG + Intergenic
1021493517 7:21246649-21246671 CTCACTTCCCAGACAGTGGGGGG + Intergenic
1022671293 7:32458665-32458687 CTCACTCACCACAAAGGGGTTGG - Intergenic
1022694655 7:32692480-32692502 CTCACTACACAGAGATGGTGTGG - Intergenic
1022923350 7:35037476-35037498 CTCACTCTCCAGCGGGCGGGCGG + Intronic
1022927836 7:35073980-35074002 CTCACTACACAGAGATGGTGTGG - Intergenic
1022942006 7:35250082-35250104 CTCAGTGCACAGAGAGGAGGAGG + Exonic
1024565094 7:50674069-50674091 CTCACTACCCAGAGTAGGGACGG - Intronic
1024910719 7:54444247-54444269 CTCACATCCCAGACAGTGGGCGG - Intergenic
1026163131 7:67888326-67888348 CTCACTTCCCAGACAGTTGGCGG - Intergenic
1026163558 7:67890469-67890491 CTCACTTCCCAGATGGTGGGTGG - Intergenic
1029421467 7:100474080-100474102 CCCTCTCCACAGAGAGGGAGTGG + Intronic
1029551114 7:101237606-101237628 CTGGTGCCCCAGAGAGGGGGAGG + Exonic
1030165852 7:106554228-106554250 CTCACTCCTCACAGAGGAGTTGG + Intergenic
1031022081 7:116638954-116638976 CTCACTTCCCAGACAGGGCCTGG - Intergenic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1033072191 7:138214355-138214377 CACACTCCCCAGGGTGGGAGTGG + Intergenic
1033073087 7:138222305-138222327 CACACTCCACAGAGCGGGAGCGG + Intergenic
1033550737 7:142445353-142445375 CTCACTGTCCAGAGAAGGGTAGG + Intergenic
1034062748 7:148108080-148108102 CTCCCTCCCCAGAGGGGAGATGG - Intronic
1034822133 7:154225851-154225873 CTGACTCCACAGAGAGAGGGTGG - Intronic
1034954904 7:155328078-155328100 GTCCCTTCCCAGAGACGGGGTGG + Intergenic
1034972512 7:155427954-155427976 CGCAGTCCCCAGAGACTGGGGGG - Intergenic
1036610556 8:10346398-10346420 CACAGTCCCTAGAGTGGGGGAGG - Intronic
1037751663 8:21686381-21686403 CTTAGTCCACAGAGAGGAGGAGG + Intergenic
1038461376 8:27720186-27720208 CTTACTTGCCAGAGAGGGTGAGG - Intergenic
1039774694 8:40723849-40723871 CTCACTACCCACACAGGGGCAGG - Intronic
1039890746 8:41683781-41683803 CCCGCTGGCCAGAGAGGGGGCGG + Intronic
1040545724 8:48396790-48396812 CTCTCACCCAAGAGAGGGGATGG - Intergenic
1040564682 8:48555114-48555136 CCCACTCCCCAGGGACAGGGAGG - Intergenic
1040916917 8:52573373-52573395 CTCACTTCCCAGACAAAGGGCGG + Intergenic
1041851207 8:62395205-62395227 CTCACTTCCCAGACCGAGGGAGG + Intronic
1041851250 8:62395340-62395362 CTCACTTCCCAGACCGAGGGAGG + Intronic
1042845139 8:73162540-73162562 CTGACTCCCCAGGGAATGGGAGG + Intergenic
1046773202 8:118137065-118137087 CACACTCCACAGAGTGGGAGTGG + Intergenic
1046876356 8:119259092-119259114 CTCACTCACCACCGAGGGGATGG + Intergenic
1048068697 8:130999488-130999510 CTAACTCCCCAGAGTGGAGGTGG + Intronic
1048292783 8:133193079-133193101 CTCACAGCCCACACAGGGGGCGG - Intronic
1048454475 8:134565613-134565635 GGCACTCCCCAGGGAGGGAGAGG + Intronic
1049234640 8:141506495-141506517 CTGAGTCCCCATAGAGGGGGCGG + Intergenic
1050139410 9:2502028-2502050 CACACTCCACAGAGTGGGAGTGG + Intergenic
1051615335 9:19000408-19000430 CTCACTTCCCAGACTGTGGGCGG - Intronic
1052413522 9:28149466-28149488 GTCACTTCCCAGAGAGGGCGGGG - Intronic
1053365736 9:37521299-37521321 CTCACTTCCCAGACAGCGTGGGG - Intronic
1053365747 9:37521339-37521361 CTCACTTCCCAGACAGTGTGGGG - Intronic
1053553436 9:39108273-39108295 CTCACTCCCCAGAGAGGGGGGGG - Intronic
1053817540 9:41928430-41928452 CTCACTCCCCAGAGAGGGCGGGG - Intronic
1054107796 9:61072102-61072124 CTCACTCCCCAGAGAGGGCGGGG - Intergenic
1054613061 9:67259023-67259045 CTCACTCCCCAGAGAGGGCGGGG + Intergenic
1054938370 9:70713343-70713365 CTCACTGACCAGAGAAGGGAAGG - Intronic
1054940061 9:70731336-70731358 CTCACTGACCAGAGAAGGGAAGG - Intronic
1055941008 9:81649752-81649774 CTGTCTCCCCAGAGGGGAGGAGG - Intronic
1056066744 9:82943430-82943452 CTGACTTCCCAGAGAGGTGATGG + Intergenic
1056229028 9:84526402-84526424 CTCACTTCCCAGACAATGGGCGG + Intergenic
1056884527 9:90428370-90428392 CTCCCTCCCAAAAGAGGGGGAGG + Intergenic
1057071815 9:92105681-92105703 GTCACTTCCCAGAGAGGGTGGGG - Intronic
1057129114 9:92641002-92641024 CGCACTCACCAGAGATGTGGGGG + Intronic
1058049603 9:100392840-100392862 CTCACTTCCCAGACAATGGGCGG - Intergenic
1058368215 9:104235030-104235052 CTCACTTCCCAGACAATGGGCGG + Intergenic
1058368245 9:104235147-104235169 CTCACTTCCCAGACAATGGGCGG + Intergenic
1060554631 9:124501919-124501941 CTCTCAGCCCAGAGAGGAGGAGG - Intronic
1060823308 9:126673628-126673650 CTCTCTGCCCAGAGTGGAGGTGG - Intronic
1061200131 9:129133214-129133236 CACATTCCCCAGACAAGGGGAGG - Intronic
1061222846 9:129262280-129262302 CCCTCTGCCCAGAGAGCGGGTGG - Intergenic
1061382748 9:130268239-130268261 CTCAGTGCCCAGAGAGGAGAGGG - Intergenic
1062011903 9:134271895-134271917 TGCACTCCCCAGAGAGGCAGCGG - Intergenic
1062424473 9:136499661-136499683 GGCTCTGCCCAGAGAGGGGGTGG + Intronic
1186407101 X:9313728-9313750 CACACTGCTCAGAGAGGTGGTGG + Intergenic
1187249531 X:17584293-17584315 CTCCCTCCCCAGGGAAGGGGTGG - Intronic
1191204148 X:57816676-57816698 CTCCCTCCATAGAGAGGGAGGGG + Intergenic
1191615064 X:63162097-63162119 CTGACTCCCCAGTGCAGGGGAGG + Intergenic
1191621234 X:63216826-63216848 CTGACTCCCCAGTGCAGGGGAGG - Intergenic
1192100183 X:68256033-68256055 CTCTCTCTACAGAGAGAGGGGGG + Intronic
1192506729 X:71690220-71690242 CCCAGTCACCAGAGAGAGGGAGG + Intergenic
1192519968 X:71791326-71791348 CCCAGTCACCAGAGAGAGGGAGG - Intergenic
1192539084 X:71953073-71953095 CCCACTCCCCAGAGACAGGCTGG - Intergenic
1193890062 X:87033505-87033527 CTCACTTCCCAGACAATGGGCGG + Intergenic
1194142238 X:90220939-90220961 CTCACCCCCAAGATAGGGGAAGG + Intergenic
1195979060 X:110558809-110558831 CTCACTTCCCAGACAGTGTGGGG + Intergenic
1199635075 X:149806319-149806341 CCCAGGCCCCAGAGAGGTGGGGG + Intergenic
1200487991 Y:3790040-3790062 CTCACCCCCAAGATAGGGGAAGG + Intergenic