ID: 1053557693

View in Genome Browser
Species Human (GRCh38)
Location 9:39154829-39154851
Sequence GGCCTCGGGGAGCACCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053557689_1053557693 -10 Left 1053557689 9:39154816-39154838 CCGGGAAGGCCGGGGCCTCGGGG 0: 2
1: 2
2: 4
3: 45
4: 408
Right 1053557693 9:39154829-39154851 GGCCTCGGGGAGCACCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053557693 Original CRISPR GGCCTCGGGGAGCACCTGCA GGG Intronic
No off target data available for this crispr