ID: 1053559320

View in Genome Browser
Species Human (GRCh38)
Location 9:39173739-39173761
Sequence CAGAGATACCAGCTTAATTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053559315_1053559320 29 Left 1053559315 9:39173687-39173709 CCTCATTCAATGTAATTAGTAAA 0: 4
1: 0
2: 3
3: 23
4: 309
Right 1053559320 9:39173739-39173761 CAGAGATACCAGCTTAATTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053559320 Original CRISPR CAGAGATACCAGCTTAATTG TGG Intronic
No off target data available for this crispr