ID: 1053559730

View in Genome Browser
Species Human (GRCh38)
Location 9:39178279-39178301
Sequence ACGTCTCTTATTGGTTTTAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 2, 1: 2, 2: 0, 3: 5, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053559728_1053559730 13 Left 1053559728 9:39178243-39178265 CCATTGCTCTGCATGGCTTTAAA 0: 4
1: 0
2: 1
3: 28
4: 325
Right 1053559730 9:39178279-39178301 ACGTCTCTTATTGGTTTTAAAGG 0: 2
1: 2
2: 0
3: 5
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053559730 Original CRISPR ACGTCTCTTATTGGTTTTAA AGG Exonic
904385209 1:30136732-30136754 ACATCTCTGATTGTTTCTAAGGG - Intergenic
905492847 1:38358412-38358434 ACGTCTTTTAATGGTCTTATTGG + Intergenic
919191274 1:194223018-194223040 ATGTCTCTTTTTGGTTATGATGG - Intergenic
924050077 1:240071649-240071671 AATTCTGTTTTTGGTTTTAATGG - Intronic
1065146151 10:22770358-22770380 CCGTATCTTATTGGTCTTCAAGG + Intergenic
1071128676 10:82366534-82366556 ACGACTCTTCATGGGTTTAAAGG + Intronic
1072231864 10:93420684-93420706 ACTTCTGCTATTGATTTTAAAGG - Intronic
1073234010 10:101997793-101997815 AAGTATCTTTTTGGGTTTAAAGG + Intronic
1075828937 10:125387304-125387326 TTGTCTTTTATTGGCTTTAATGG - Intergenic
1078767447 11:14312256-14312278 ACGTGTCTTATTCTTTTCAATGG - Intronic
1080691573 11:34563208-34563230 ACTTCTCTTTTTGGCTGTAATGG - Intergenic
1088689096 11:112309949-112309971 ACATGTCTAATTGATTTTAAAGG - Intergenic
1090740937 11:129659371-129659393 AGATTTCTCATTGGTTTTAAAGG - Intergenic
1092082321 12:5726733-5726755 CCTTCTCTTATTGATTTTCAAGG - Intronic
1097960207 12:65524937-65524959 ACGTATTTTACTGGTTATAAAGG + Intergenic
1101773083 12:107769645-107769667 AACTCTCTTATTAGTTCTAAAGG - Intergenic
1110309207 13:74027603-74027625 ACCACTGTTTTTGGTTTTAAGGG - Intronic
1110523144 13:76504710-76504732 ATGTCTCTGATTTGTTTAAAGGG + Intergenic
1112512042 13:100018584-100018606 AATTCTCTTATTAATTTTAATGG - Intergenic
1115422094 14:33206957-33206979 ACGACTCTTGTTGCTGTTAATGG + Intronic
1115740753 14:36385339-36385361 ACCTCCCTTATTGGTTTTTTAGG - Intergenic
1118160563 14:63285504-63285526 ACATCTCTTTTTGGTCTCAAAGG + Intronic
1118528564 14:66674513-66674535 ACCTCTTTTTTTGTTTTTAATGG + Intronic
1125166826 15:36715876-36715898 ACTTCTCATAATGGTTATAATGG + Intronic
1126503569 15:49376846-49376868 AAGTATCTTATTTGTTTTCATGG + Intronic
1130805883 15:87321487-87321509 ACATCCCTAATTGGATTTAATGG + Intergenic
1131729478 15:95264498-95264520 AAGTTTCTTCTTGGTATTAAGGG - Intergenic
1138795795 16:59967430-59967452 TAGTCTTTTATTGGTGTTAAAGG + Intergenic
1139529808 16:67537577-67537599 ACCTCTCTTCTTGGTGTTCATGG - Intronic
1147221821 17:38938330-38938352 AAATCTGGTATTGGTTTTAATGG - Intronic
1155090225 18:22501747-22501769 TCATCTCTTATTGGTTTTGGGGG - Intergenic
1156112655 18:33746027-33746049 AAGTCTCTTAGTGGTTTCCATGG - Exonic
1156147138 18:34197255-34197277 AAATCTATTATTGGTTTAAAAGG - Intronic
1156736605 18:40267185-40267207 AAGTAGATTATTGGTTTTAAGGG + Intergenic
1158353136 18:56585534-56585556 AACTCTTTTATTAGTTTTAATGG - Intergenic
928977671 2:37105620-37105642 TTGTTTCTTATTGGTTTAAATGG - Exonic
929347493 2:40904209-40904231 AAGTCTTTTATTGGTTTTATTGG + Intergenic
937493141 2:122390423-122390445 ATGTCCCTTATTAGTCTTAAGGG + Intergenic
938543659 2:132307291-132307313 ATGTCTCTTAAAGGTATTAAAGG + Intergenic
939254661 2:139727476-139727498 ACTTTTCGTATTGCTTTTAAAGG + Intergenic
940985874 2:160051726-160051748 TCCTCACTTATTGGTTTGAAAGG - Intronic
942740316 2:179168971-179168993 ATGTCTCTTAATTATTTTAATGG - Intronic
944721942 2:202432064-202432086 ACATAACTTATTGTTTTTAATGG - Intronic
945679739 2:212899314-212899336 TCTTATCTTATTGGATTTAAAGG - Intergenic
946721456 2:222613135-222613157 ATGTCTCTCATTTCTTTTAATGG - Intronic
946963182 2:225006658-225006680 ACATCTCTTATTTGTATTGATGG + Intronic
948246067 2:236487191-236487213 ACGGCACTTCATGGTTTTAAAGG + Intronic
948248981 2:236510141-236510163 ACCTCTATTCTTGGTGTTAAGGG - Intergenic
1169789015 20:9389857-9389879 ACGTTTTTTTTTGTTTTTAAAGG + Exonic
1171872524 20:30540017-30540039 ATGTCTCTTAAAGGTATTAAAGG + Intergenic
1173333232 20:42092969-42092991 TGGACTCTTATTTGTTTTAAAGG + Intronic
1173545060 20:43890681-43890703 TTTTCTCTTATTTGTTTTAAAGG + Intergenic
1174884652 20:54320009-54320031 TCGTCACTTTTTGGTTTAAATGG + Intergenic
1175318741 20:58070605-58070627 ACCTGTCTGCTTGGTTTTAAGGG + Intergenic
1178171432 21:30044768-30044790 ATGTATCTTCTTGGTTTTAGTGG - Intergenic
1181731504 22:24850258-24850280 CCGTCTTTTATTGGTCTTGAAGG + Exonic
949224416 3:1676762-1676784 AATTCACTTATTAGTTTTAATGG + Intergenic
950151412 3:10690236-10690258 GTGTCTCTTACTGATTTTAAAGG - Intronic
955717162 3:61842254-61842276 ACGTTTCTTATTGCTTCTAAAGG + Intronic
958051411 3:88352002-88352024 ACTTATCATATTGCTTTTAAAGG + Intergenic
967611664 3:191513275-191513297 ACCTCTCTTACTGGATTCAAGGG + Intergenic
970447557 4:16136821-16136843 ATGTCACCTATTGGTTATAAAGG - Intergenic
971986753 4:33835979-33836001 ATGCCTCTTATTTATTTTAATGG - Intergenic
972842585 4:42948925-42948947 AAGTCTCATATGGGTTTCAATGG - Intronic
973332771 4:48926165-48926187 TCTGCTCTTATTGGTTGTAATGG + Intergenic
974144438 4:57929455-57929477 TCTTCACTTATTGGATTTAATGG + Intergenic
975685218 4:76914047-76914069 ACTTATCTTATTGGTTTGATGGG - Intergenic
975722298 4:77260062-77260084 ACTTATCTTCTAGGTTTTAAGGG - Intronic
976949186 4:90808670-90808692 ACATCTCATTGTGGTTTTAATGG - Intronic
977333840 4:95670393-95670415 AAGTCACTTATTTGTTCTAATGG + Intergenic
978936103 4:114377836-114377858 ATGTCTCTTTGTGGTTTTAATGG + Intergenic
980918850 4:139062057-139062079 ATGTCTGTCATTGTTTTTAAAGG - Exonic
981560157 4:146039631-146039653 TTGTTTCTTATTAGTTTTAATGG + Intergenic
981855428 4:149285019-149285041 AGTTATCTTATTGGTATTAATGG + Intergenic
985187163 4:187330311-187330333 ACTTTTGTTATTGCTTTTAAGGG + Intergenic
986724937 5:10587920-10587942 ACGTCTCTTATTGGCTCTCTGGG + Intronic
987842723 5:23241469-23241491 AGGTTTTTTATTGGTTTTCAAGG + Intergenic
992194119 5:74323049-74323071 ATGTCTCTTATTATTTTGAATGG - Intergenic
996279660 5:121713509-121713531 ATGTATTTTCTTGGTTTTAAGGG - Intergenic
996306746 5:122055584-122055606 ATATCTTTTATTGGTTTTACTGG - Intronic
997910532 5:137867715-137867737 ACGTGTCTTAGTGGTATTTAAGG - Intergenic
999752063 5:154635204-154635226 AAATCTCTAATTGGTTTTAAAGG + Intergenic
1001045502 5:168368462-168368484 ACGTATCTTCTTGGTTTTCTGGG + Intronic
1011994457 6:93567447-93567469 TCGTCTGTTCTTGGTTTCAAGGG - Intergenic
1018544152 6:164917311-164917333 ATAACTCTTATTGGTTTTGATGG + Intergenic
1023132811 7:37019618-37019640 AGGTTTATTATTGTTTTTAAAGG + Intronic
1024402224 7:48938285-48938307 ACTTGACTTATTGTTTTTAAGGG - Intergenic
1027989474 7:85338720-85338742 AATTCTCTTATTGTTTTTACTGG + Intergenic
1029675268 7:102064343-102064365 CCGGCTCTAAATGGTTTTAAGGG + Intronic
1031188878 7:118520476-118520498 ATGTCTGTTATTGGTTCTATCGG - Intergenic
1032701982 7:134390119-134390141 ACTTCTGTTATTTGATTTAAAGG - Intergenic
1039963951 8:42270811-42270833 AGGTCTTTTCTTGTTTTTAAGGG + Intergenic
1040936962 8:52791621-52791643 ACTTTTCTTGTTGGTTTTTAGGG - Intergenic
1041978117 8:63822826-63822848 ACCTCTCTGATTGTTTTGAAAGG + Intergenic
1042274443 8:66988577-66988599 ATGTCAGTTATTGTTTTTAAAGG + Intronic
1042411467 8:68471173-68471195 GCTTCACTTAATGGTTTTAAGGG + Intronic
1043398216 8:79858658-79858680 CCCTTTCTTCTTGGTTTTAAAGG + Intergenic
1046501268 8:115080459-115080481 GCATCTGTTATTGGTTTTAATGG + Intergenic
1048945163 8:139440082-139440104 ACGTGTTTTATCAGTTTTAAAGG + Intergenic
1049120923 8:140736554-140736576 AGGTTTCTTGTTTGTTTTAAAGG - Intronic
1053559730 9:39178279-39178301 ACGTCTCTTATTGGTTTTAAAGG + Exonic
1053639487 9:40056904-40056926 CTTTCTCTTATTGATTTTAATGG - Intergenic
1053766592 9:41408210-41408232 CTTTCTCTTATTGATTTTAATGG + Intergenic
1053823837 9:41998523-41998545 ACATCTCTTATTGGTTTTAAAGG + Exonic
1054137385 9:61440664-61440686 ACGTCTCTTATTGGTTTTAAAGG - Intergenic
1054320290 9:63653563-63653585 CTTTCTCTTATTGATTTTAATGG - Intergenic
1054545261 9:66319715-66319737 CTTTCTCTTATTGATTTTAATGG + Intergenic
1054606735 9:67188844-67188866 ACATCTCTTATTGGTTTTAAAGG - Intergenic
1059811282 9:117858333-117858355 ACCTCTGTAATTGGTTTCAAAGG + Intergenic
1060083614 9:120676539-120676561 AACTCTCTTATTGTTTCTAATGG + Intronic
1190486805 X:50934921-50934943 CCGTGACTTATTGGTTTTGAGGG + Intergenic
1194243762 X:91483863-91483885 AGGGCTATTATTGATTTTAAAGG - Intergenic
1194854926 X:98916444-98916466 AGGTCTGTTAGTGGTTTTGAAGG - Intergenic
1199776573 X:151017069-151017091 CCGTCTCCTATTGCTATTAATGG - Intergenic
1200562743 Y:4725227-4725249 AGGGCTATTATTGATTTTAAAGG - Intergenic