ID: 1053559776

View in Genome Browser
Species Human (GRCh38)
Location 9:39179153-39179175
Sequence CTGAAGTTCTCTAGGAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053559774_1053559776 13 Left 1053559774 9:39179117-39179139 CCAATCAGTTGAAGGCTGTAAGA 0: 4
1: 15
2: 101
3: 316
4: 656
Right 1053559776 9:39179153-39179175 CTGAAGTTCTCTAGGAAAGAAGG No data
1053559773_1053559776 19 Left 1053559773 9:39179111-39179133 CCTCATCCAATCAGTTGAAGGCT 0: 32
1: 235
2: 564
3: 821
4: 1049
Right 1053559776 9:39179153-39179175 CTGAAGTTCTCTAGGAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053559776 Original CRISPR CTGAAGTTCTCTAGGAAAGA AGG Intronic
No off target data available for this crispr