ID: 1053561068

View in Genome Browser
Species Human (GRCh38)
Location 9:39194621-39194643
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 4, 1: 0, 2: 0, 3: 11, 4: 133}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053561068_1053561076 7 Left 1053561068 9:39194621-39194643 CCAACCACCAATGGGTGTCCCTG 0: 4
1: 0
2: 0
3: 11
4: 133
Right 1053561076 9:39194651-39194673 ACACATGGAAATAAAAATATAGG No data
1053561068_1053561077 27 Left 1053561068 9:39194621-39194643 CCAACCACCAATGGGTGTCCCTG 0: 4
1: 0
2: 0
3: 11
4: 133
Right 1053561077 9:39194671-39194693 AGGAAATGCCTTAGTGAATGTGG No data
1053561068_1053561073 -8 Left 1053561068 9:39194621-39194643 CCAACCACCAATGGGTGTCCCTG 0: 4
1: 0
2: 0
3: 11
4: 133
Right 1053561073 9:39194636-39194658 TGTCCCTGGGTATAAACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053561068 Original CRISPR CAGGGACACCCATTGGTGGT TGG (reversed) Intronic
900185036 1:1328926-1328948 CAGGGGCACCCAGTGAGGGTGGG + Intergenic
900950726 1:5857022-5857044 CTGGGAAACCCCTTGCTGGTGGG - Intergenic
900968714 1:5977306-5977328 CAGGGAGACCCAGGGGTGTTAGG - Intronic
901661725 1:10802443-10802465 CATTGACAACCATAGGTGGTAGG - Intergenic
903452065 1:23460605-23460627 CAGAAACTCCCATTGTTGGTGGG + Intronic
903856164 1:26338522-26338544 AAGGGACACAGATTGGTGGGCGG + Intronic
905043014 1:34976125-34976147 CAGGGAGACGCAGGGGTGGTGGG + Intergenic
905690746 1:39940969-39940991 CTGGGACACAGGTTGGTGGTGGG + Intergenic
905914419 1:41675047-41675069 CAGGGACACCCATGGGAGGATGG - Intronic
911064175 1:93772958-93772980 CATGGATAGTCATTGGTGGTAGG + Intronic
912666315 1:111583153-111583175 CAGGGAAAGACATTGGGGGTTGG - Intronic
913995666 1:143650442-143650464 CAGGGAGACTTTTTGGTGGTTGG + Intergenic
920011772 1:202873385-202873407 CAGGGATACCCAGTGATGGAGGG - Intergenic
921627244 1:217390393-217390415 CAGGAACTCTCATTGCTGGTAGG + Intergenic
923092224 1:230749400-230749422 CAGGGAGACCTAATGGTCGTGGG - Intronic
923256319 1:232224459-232224481 CAGGGTCATCCAGAGGTGGTGGG - Intergenic
1062760943 10:18298-18320 CAGGTACACCAATTAGTGTTAGG - Intergenic
1063053747 10:2480887-2480909 CAGGGACCCCCACAGATGGTGGG - Intergenic
1063095573 10:2905777-2905799 CTGGGACACCCATTAATTGTTGG + Intergenic
1064572356 10:16707345-16707367 AAGGGAAACACATTGTTGGTGGG - Intronic
1067081076 10:43212498-43212520 CCAGGCCTCCCATTGGTGGTCGG + Intronic
1070528486 10:77315753-77315775 CAGTGCCACCCATTGGCAGTGGG + Intronic
1070833161 10:79432437-79432459 CGGGGCCACTCATTGGTGGAAGG + Intronic
1071932757 10:90491682-90491704 CAGGGACACACATGTGTGGCAGG - Intergenic
1074814221 10:117132820-117132842 CAGGGACGCCGCTGGGTGGTCGG - Intronic
1075908283 10:126101992-126102014 CAGGAACACCCAAAGATGGTGGG - Intronic
1076870003 10:133188528-133188550 CAGGGACACCCACTGTGGGCAGG - Exonic
1077502877 11:2917146-2917168 GAGGGGCACTCATTGGTGGAGGG + Intronic
1078250889 11:9615378-9615400 CAGAGACTCCCATGTGTGGTTGG - Intergenic
1079081015 11:17413797-17413819 CAGGGAAAACCACTGCTGGTTGG + Intronic
1082994743 11:59244291-59244313 CTTGGACAACCATTGGTAGTAGG - Intergenic
1083499333 11:63088938-63088960 CAGGGACACCAATTTATCGTAGG - Intronic
1086443623 11:86851896-86851918 AAAGGACAACCATTGGTGGGGGG + Intronic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1089835684 11:121368423-121368445 CAGGTGCAGCTATTGGTGGTGGG - Intergenic
1092134890 12:6140082-6140104 AAGGGAGATCCATTAGTGGTTGG + Intergenic
1092465309 12:8726169-8726191 CAGGAACTCTCATTGCTGGTGGG - Intronic
1092666483 12:10805406-10805428 TAGGAACACCCCTTGGTGGGTGG + Intergenic
1094498738 12:31005466-31005488 GACAGACACCCATCGGTGGTGGG + Intergenic
1094826727 12:34275291-34275313 CAGGGACACCCTTGGGAGGGTGG + Intergenic
1100786685 12:98086331-98086353 CAGCTTCAACCATTGGTGGTGGG - Intergenic
1103956134 12:124577927-124577949 CAGGGTCTCCCATTGCTTGTAGG - Intergenic
1105350005 13:19606429-19606451 CAGGGACACCCTTTTGTCTTGGG - Intergenic
1109702293 13:66042201-66042223 CAGGGACACCTATTAGTGATAGG + Intergenic
1110016558 13:70413273-70413295 AAGGGCCACACATTGGTAGTAGG - Intergenic
1110758959 13:79208686-79208708 CAGGGCAGCCCAGTGGTGGTGGG - Intergenic
1114211152 14:20616168-20616190 CTGGGACAACCTTTGATGGTAGG - Intergenic
1120545628 14:85808278-85808300 CAGGAACACCGATTAGTGTTAGG + Intergenic
1121632774 14:95433092-95433114 CAGGGACACTCATGGGTTCTGGG - Intronic
1122793739 14:104195392-104195414 CGGGGACACCCAATGGCTGTGGG - Intergenic
1126245951 15:46505884-46505906 CAAGGATACCCATTTGTGATTGG - Intergenic
1126790330 15:52215548-52215570 CAGGGACACAGAATGGTGGCAGG - Intronic
1128311573 15:66634282-66634304 CAGGGCCACCCATTTGTAGGCGG + Intronic
1132024558 15:98393857-98393879 CATGCACACCCACTGGTGGTAGG - Intergenic
1135194178 16:20380954-20380976 CAGGGACCTCCTTTGGTGCTTGG + Intronic
1135752377 16:25067302-25067324 CAGGGACAGGCAGTGGTGATTGG + Intergenic
1136278735 16:29194624-29194646 CTGTGCCTCCCATTGGTGGTGGG + Intergenic
1139613085 16:68072787-68072809 CTGGGACACCCAGTGGAAGTCGG - Intronic
1141482739 16:84317818-84317840 CAGAGACAGACATTTGTGGTAGG + Intronic
1141594437 16:85088713-85088735 CCGGCACACCCAGTGGTGGAGGG + Exonic
1144579107 17:16447964-16447986 CAGAGGCAACCATGGGTGGTAGG + Intronic
1147611231 17:41803019-41803041 CCTGGACACCCATTGGGAGTGGG - Intronic
1147952169 17:44113304-44113326 CAGGGACACCCAGAGGTGGCTGG + Intronic
1148270379 17:46258017-46258039 CAAGGTCACTCATTGGTTGTTGG + Intergenic
1150915119 17:69429059-69429081 CAGGGACAGGACTTGGTGGTTGG + Intronic
1152953850 18:18652-18674 CAGGTACACCAATTAGTGTTAGG - Intergenic
1156580289 18:38367091-38367113 CAGAGACACTCCTTGGTGGGAGG + Intergenic
1157442588 18:47722032-47722054 CAGGGCCGGCCATTGCTGGTGGG + Intergenic
1161612718 19:5251946-5251968 CAGGGACAGACATAGATGGTGGG - Intronic
1161673745 19:5630080-5630102 CACCGTCACCCATTGTTGGTAGG - Intronic
1164559337 19:29278010-29278032 AATGGGCACCCCTTGGTGGTTGG - Intergenic
1165947731 19:39454914-39454936 CAGGGACACCCATATGTTGGTGG + Intronic
1166296495 19:41892577-41892599 CAGGGACACACATGGGGGCTAGG - Intronic
1168158968 19:54495612-54495634 CAGGAACTCTCATTGCTGGTGGG + Intergenic
925288761 2:2732523-2732545 CAGAGACAGCCATGGGTGGCCGG + Intergenic
931029979 2:58163024-58163046 CAGGAACATACATTTGTGGTAGG - Exonic
932476025 2:72006421-72006443 CAGGGCCATGAATTGGTGGTAGG + Intergenic
934881515 2:97984897-97984919 CAGGGATACCCATTGGACTTGGG - Intronic
935756890 2:106283357-106283379 CAGAGACAGGAATTGGTGGTTGG + Intergenic
936075259 2:109397701-109397723 CAGGCACACCCACTGGGGGAAGG - Intronic
936112675 2:109677679-109677701 CAGAGACAGGGATTGGTGGTTGG - Intergenic
937009974 2:118553799-118553821 CAGATACATTCATTGGTGGTAGG + Intergenic
940316271 2:152330799-152330821 CAGGGTAATCCAGTGGTGGTGGG - Intergenic
942073332 2:172335061-172335083 GAGGGACCCCCAATGGTGCTGGG - Intergenic
945251022 2:207766994-207767016 CAGGGACACCTGCTTGTGGTAGG + Exonic
945487592 2:210416036-210416058 CAGGGACACCAATGAGTTGTAGG + Intergenic
1174482514 20:50841634-50841656 CAGGGAGCCCCATTGGAGGGAGG + Intronic
1175158869 20:56993183-56993205 CAGGAACAGTCATAGGTGGTAGG + Intergenic
1175650186 20:60715187-60715209 CAGTTAAAACCATTGGTGGTCGG - Intergenic
1179185216 21:39080602-39080624 CAGGGAAAGCCATTGCTGGCTGG - Intergenic
1182790800 22:32951264-32951286 CAGGGAAGCCCTTTGGTGGTGGG - Intronic
1183639403 22:39083929-39083951 CAGGGACACCCATGGGCAGAAGG + Intronic
1185068922 22:48645693-48645715 CCACGACACCCATGGGTGGTGGG + Intronic
950373376 3:12549973-12549995 CAGGAACTCTCATTGCTGGTGGG + Intronic
960088853 3:113618534-113618556 CAGTAACACTCATTGCTGGTGGG - Intronic
961480476 3:127176296-127176318 CTGGGAGAGCCATTGGTGCTGGG - Intergenic
963906608 3:150778736-150778758 CAGTAACACCCATGGGTGGTTGG + Intergenic
965147613 3:164926853-164926875 CAGGGACACTAATGAGTGGTAGG + Intergenic
966273200 3:178133775-178133797 CCGGCACATCCATTGGCGGTAGG + Intergenic
970779849 4:19723755-19723777 TAGGGACATTCATTGGTGGCAGG + Intergenic
977379642 4:96255952-96255974 CAGGGCAATCCAGTGGTGGTGGG - Intergenic
979679536 4:123444465-123444487 CAGGGAGGCCCAGTGGTGGGGGG - Intergenic
986181016 5:5393018-5393040 CAGGGACACACTGTGATGGTGGG + Intergenic
987707111 5:21471502-21471524 CAGGGACACACTGTGATGGTGGG - Intergenic
988434672 5:31159924-31159946 CAGGAACACTCATTGCTGCTGGG - Intergenic
994097295 5:95858646-95858668 GGGGTACACCCATTTGTGGTGGG - Intronic
997217695 5:132128035-132128057 CAGGTACACCCATTAATTGTAGG + Intergenic
997237076 5:132278818-132278840 CAGGGGCACCCAGAGGTGGAGGG - Intronic
997479052 5:134169308-134169330 CAGGGATAGGCATTGGTGGGAGG - Intronic
998038893 5:138938277-138938299 GAGGGACACGCATTGGTGACGGG - Intergenic
998940988 5:147281624-147281646 CAGGGACACCCATTATTCTTAGG - Intronic
1005587583 6:27291841-27291863 CATGGATTCCCATTGTTGGTAGG + Intronic
1006825518 6:36932034-36932056 CAGGAACTCTCATTGCTGGTAGG - Intergenic
1007240436 6:40420934-40420956 CAGGGGCTCCCATTAGGGGTGGG - Intronic
1009021116 6:57949006-57949028 CAGGGACACACTGTGATGGTGGG + Intergenic
1012885196 6:104838439-104838461 CAAGAACACACATTGGAGGTAGG + Intronic
1014710393 6:124799870-124799892 CCAGGACACCCACTGCTGGTAGG - Intronic
1016980322 6:149847683-149847705 CAGTAACAGCCTTTGGTGGTTGG + Intronic
1017907939 6:158769601-158769623 CAGGGTCACCCATTGAAGGTGGG - Intronic
1019585615 7:1800940-1800962 CAGGGTCACTCCTGGGTGGTGGG - Intergenic
1020094761 7:5362093-5362115 CAGGGGCACCCCTGGGTGGGCGG - Intronic
1020373103 7:7456067-7456089 CAGGGATACCCATTGGTCCTTGG + Exonic
1021861889 7:24914055-24914077 CAGGGAAGCCCATTTGTGGTGGG - Intronic
1021951454 7:25779060-25779082 CAGGGACACTCATGAGGGGTGGG - Intergenic
1023078357 7:36505088-36505110 AAAGGACACCCAGTGGTGGGTGG - Intergenic
1028348965 7:89819606-89819628 CAGGACCACACATTGGTGGCTGG + Intergenic
1033467784 7:141611869-141611891 CAGGAACTCTCATTGTTGGTAGG + Intronic
1035635231 8:1139218-1139240 GAGGGGCAGCCATTGGTGGCTGG - Intergenic
1038435750 8:27534862-27534884 CAGAGTTACCCCTTGGTGGTGGG + Intronic
1039244634 8:35595627-35595649 CAGGGACTCCCTCTGGTGGGCGG - Exonic
1041409337 8:57536115-57536137 CAGAGACACCCAGTCCTGGTGGG + Intergenic
1041669716 8:60479957-60479979 CAGGGACACCCAGTACTGGTGGG + Intergenic
1047777026 8:128080348-128080370 CAGGGACTCTCATTGTTGGTGGG - Intergenic
1049783943 8:144441651-144441673 CAGAGACCACCATTGGAGGTTGG - Intronic
1053055572 9:34991458-34991480 CAGGGACACCAAAAGGAGGTGGG + Intronic
1053447846 9:38166593-38166615 CAGAGACACCCAGTGGTACTGGG - Intergenic
1053561068 9:39194621-39194643 CAGGGACACCCATTGGTGGTTGG - Intronic
1053825166 9:42014866-42014888 CAGGGACACCCATTGGTGGTTGG - Intronic
1054136051 9:61424336-61424358 CAGGGACACCCATTGGTGGTTGG + Intergenic
1054605401 9:67172495-67172517 CAGGGACACCCATTGGTGGTTGG + Intergenic
1060937249 9:127522652-127522674 AAGGGAGACCCACAGGTGGTAGG - Intronic
1186433101 X:9521322-9521344 CAGGGAAAGCCAGAGGTGGTGGG + Intronic
1191641745 X:63434182-63434204 CAGGGTCACCCAGTGGTGACCGG + Intergenic
1195829429 X:109039795-109039817 TAAGGAAACCCATAGGTGGTAGG - Intergenic
1197522786 X:127520304-127520326 CTGGGAGACCCATTGCAGGTTGG - Intergenic
1199334490 X:146602216-146602238 CAGAGACAAGCATTGGTGGATGG + Intergenic
1199420933 X:147643943-147643965 CAGGAACAATCATTGGTGGAAGG - Intergenic
1200796533 Y:7346115-7346137 CAGGGACACCCATAGGCAGGGGG - Intergenic