ID: 1053567840

View in Genome Browser
Species Human (GRCh38)
Location 9:39271588-39271610
Sequence CAATTCCTACAGTCTACCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053567839_1053567840 -8 Left 1053567839 9:39271573-39271595 CCGGGACATGACAGACAATTCCT 0: 4
1: 0
2: 0
3: 8
4: 158
Right 1053567840 9:39271588-39271610 CAATTCCTACAGTCTACCTGTGG No data
1053567835_1053567840 14 Left 1053567835 9:39271551-39271573 CCAGCTGATGAGTGTCTGGTTCC 0: 4
1: 1
2: 0
3: 2
4: 114
Right 1053567840 9:39271588-39271610 CAATTCCTACAGTCTACCTGTGG No data
1053567838_1053567840 -7 Left 1053567838 9:39271572-39271594 CCCGGGACATGACAGACAATTCC 0: 4
1: 0
2: 0
3: 9
4: 126
Right 1053567840 9:39271588-39271610 CAATTCCTACAGTCTACCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053567840 Original CRISPR CAATTCCTACAGTCTACCTG TGG Intronic
No off target data available for this crispr