ID: 1053576513

View in Genome Browser
Species Human (GRCh38)
Location 9:39360509-39360531
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 907
Summary {0: 9, 1: 0, 2: 12, 3: 110, 4: 776}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053576505_1053576513 -8 Left 1053576505 9:39360494-39360516 CCTTGAAGCCTCCTCCAGCTGGA 0: 5
1: 0
2: 9
3: 28
4: 244
Right 1053576513 9:39360509-39360531 CAGCTGGACAGGAGGGCAGGTGG 0: 9
1: 0
2: 12
3: 110
4: 776
1053576502_1053576513 14 Left 1053576502 9:39360472-39360494 CCATCTTGGAATGATCATGGGCC 0: 2
1: 2
2: 4
3: 9
4: 97
Right 1053576513 9:39360509-39360531 CAGCTGGACAGGAGGGCAGGTGG 0: 9
1: 0
2: 12
3: 110
4: 776
1053576501_1053576513 15 Left 1053576501 9:39360471-39360493 CCCATCTTGGAATGATCATGGGC 0: 2
1: 2
2: 5
3: 9
4: 70
Right 1053576513 9:39360509-39360531 CAGCTGGACAGGAGGGCAGGTGG 0: 9
1: 0
2: 12
3: 110
4: 776
1053576503_1053576513 -7 Left 1053576503 9:39360493-39360515 CCCTTGAAGCCTCCTCCAGCTGG 0: 5
1: 0
2: 0
3: 23
4: 215
Right 1053576513 9:39360509-39360531 CAGCTGGACAGGAGGGCAGGTGG 0: 9
1: 0
2: 12
3: 110
4: 776
1053576498_1053576513 26 Left 1053576498 9:39360460-39360482 CCGCGAGGAATCCCATCTTGGAA 0: 5
1: 0
2: 3
3: 4
4: 70
Right 1053576513 9:39360509-39360531 CAGCTGGACAGGAGGGCAGGTGG 0: 9
1: 0
2: 12
3: 110
4: 776

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900373662 1:2343713-2343735 CAGCTTCACAGGGTGGCAGGAGG + Intronic
900571692 1:3361795-3361817 CTGCGGTCCAGGAGGGCAGGTGG + Intronic
900571717 1:3361898-3361920 CTGCGGTCCAGGAGGGCAGGTGG + Intronic
900571725 1:3361931-3361953 CCGCGGCCCAGGAGGGCAGGTGG + Intronic
901489336 1:9588830-9588852 CAGGCGGGCAGGCGGGCAGGAGG - Intergenic
901489339 1:9588838-9588860 CAGGCGGGCAGGCGGGCAGGCGG - Intergenic
901509688 1:9710682-9710704 CAGATGGACAGGTGGACAGACGG + Intronic
901691498 1:10976257-10976279 CTGCGGGAGAGGAGGGAAGGGGG + Intronic
901803657 1:11724274-11724296 GAGCTGAGCAGGAGGCCAGGTGG + Exonic
902388391 1:16088834-16088856 CAGGTGGGCAGGTGGGCAGCGGG + Intergenic
902398518 1:16145120-16145142 CCGCTGGTCAGGTGAGCAGGTGG - Intronic
902733883 1:18387319-18387341 CAGCAGGCCAGGAGCTCAGGAGG + Intergenic
903278448 1:22236396-22236418 CAGCTCGGCAGGATGGCAGCTGG + Intergenic
903513031 1:23890778-23890800 CAGCTGGGCAGCAGGTCAAGAGG - Intronic
903666204 1:25009133-25009155 CAGCTGGAAAGAAGAGCCGGCGG - Intergenic
903800546 1:25964011-25964033 CAGCAGGGGAGGAGGCCAGGAGG + Intronic
903862639 1:26374189-26374211 CAGCAAGACAGCAGGGGAGGCGG - Intronic
904206610 1:28859500-28859522 TAGCTGGCCAGGGGGGCATGCGG + Intronic
904801540 1:33096531-33096553 CAGCTGGCCAAGAAGGTAGGAGG - Intronic
905162537 1:36049192-36049214 CTACTAGAGAGGAGGGCAGGGGG + Intronic
905223951 1:36467309-36467331 CTGCTGGAGAAGGGGGCAGGTGG + Exonic
905927659 1:41763331-41763353 CCCCTGTGCAGGAGGGCAGGAGG - Intronic
906234179 1:44194021-44194043 CAGCTGGACAGAAATGCAGGTGG + Intergenic
906449955 1:45936988-45937010 CAGCTACTCAGGAGGCCAGGTGG - Intronic
906532029 1:46529298-46529320 AAGCTGGAGAGGCGGGGAGGGGG - Intergenic
906572783 1:46858694-46858716 CAGCAGAACTGGGGGGCAGGAGG + Intergenic
906580255 1:46930086-46930108 CAGGAAGACAGGACGGCAGGTGG + Exonic
906598986 1:47107194-47107216 CAGCAGAACTGGGGGGCAGGAGG - Intronic
906603472 1:47148804-47148826 CAGGAAGACAGGATGGCAGGTGG - Exonic
906949405 1:50322327-50322349 CACCCTGAGAGGAGGGCAGGTGG + Intergenic
907337491 1:53709943-53709965 CAGATGTACAGGATGGGAGGGGG + Intronic
908495434 1:64689670-64689692 TAGCTGGAGGGTAGGGCAGGTGG - Intronic
910060179 1:83081526-83081548 GAGCTGGAGAGGTAGGCAGGAGG + Intergenic
910245334 1:85132697-85132719 CAGGAGGGCAGGTGGGCAGGAGG - Intronic
910245337 1:85132705-85132727 CAGGAAGGCAGGAGGGCAGGTGG - Intronic
910728025 1:90359327-90359349 CAGCTGAAAAGGAGGTGAGGTGG + Intergenic
911450719 1:98056983-98057005 CAGCATGACAGGAGGCCATGTGG - Intergenic
911658675 1:100475549-100475571 CAGCTGGGTTGGGGGGCAGGGGG + Intronic
912334104 1:108846612-108846634 CAGCTGGGGAGGAGCGGAGGCGG - Intronic
912450438 1:109764753-109764775 GAGCAGGGCAGGAGGGGAGGCGG + Intronic
912692909 1:111818217-111818239 CCTCTGGGCAGGAGGGAAGGAGG + Intronic
912701567 1:111882036-111882058 CAGCTGTAGAGGGAGGCAGGTGG + Intronic
914433213 1:147638596-147638618 AGGCTGGAGAGGTGGGCAGGGGG + Intronic
914815750 1:151060646-151060668 CAGCTGAAGAGGAGAGAAGGGGG + Intronic
914918569 1:151832754-151832776 CAGCTGGGAACGAGAGCAGGAGG - Intergenic
915106973 1:153540803-153540825 CAGCGGGCAGGGAGGGCAGGGGG + Intronic
916170541 1:161998501-161998523 AAGGTGTACAGGAGCGCAGGTGG + Intronic
916608796 1:166369620-166369642 AAGGAGGAAAGGAGGGCAGGAGG - Intergenic
916867775 1:168878760-168878782 CACCTAGACTGGAGGGCAGTGGG - Intergenic
917906644 1:179591999-179592021 GAGGTGGAAAGGAAGGCAGGAGG - Exonic
918189894 1:182163967-182163989 CAGCAGGACAAGAGGTCAGGAGG + Intergenic
919607757 1:199706784-199706806 CAGCAGGTCAGAAGGGCAGAAGG + Intergenic
919849181 1:201660875-201660897 CAGGTGGCCAGGGTGGCAGGGGG + Intronic
920076767 1:203342791-203342813 TAGCAGGATAGGGGGGCAGGTGG + Intronic
920385492 1:205568342-205568364 CACCTGGCCAGGTGGGGAGGAGG + Intergenic
921036330 1:211382677-211382699 CTGCTGGACTGGAGGGAGGGAGG - Intergenic
921176030 1:212595386-212595408 TAGCTGGACTTGAAGGCAGGGGG - Intronic
921221422 1:212976763-212976785 CAGATGGGCAGGAGGGCAGAGGG - Intronic
922024663 1:221739394-221739416 CATCTGGTTAGCAGGGCAGGTGG + Exonic
922225259 1:223640488-223640510 AACCTGGACAAGAAGGCAGGTGG - Intronic
922244230 1:223778959-223778981 CGGCAGGAGAGGAAGGCAGGAGG - Intergenic
922312512 1:224408654-224408676 GAGTTGGACAGGAGGGCAAGAGG + Intronic
922740842 1:228013527-228013549 CAGCTGGGCCGGCGGGCAGGAGG + Intronic
923280264 1:232436769-232436791 GAGCTGCACAGGAGGCGAGGAGG - Intronic
923434508 1:233955589-233955611 CAGCAAGACAGGGGGGCAGAAGG - Intronic
923525490 1:234769435-234769457 CAGCTGGCCTGGGGGGCATGTGG - Intergenic
924559108 1:245143140-245143162 CAGATGGACGGGTGGACAGGTGG - Intergenic
924740285 1:246790887-246790909 CAGCTGCGGAGGATGGCAGGTGG + Intergenic
1062856283 10:781043-781065 AAGCAGCCCAGGAGGGCAGGTGG - Intergenic
1062908930 10:1199622-1199644 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1063168617 10:3486178-3486200 CAGCCCGCCAGGAGGGCAGGAGG + Intergenic
1063353109 10:5374213-5374235 AGGCTGGACGGGAGGGCAGCGGG + Exonic
1063541484 10:6938552-6938574 CAGCTGAGCAGAAGTGCAGGTGG + Intergenic
1063949502 10:11208800-11208822 CTGAGAGACAGGAGGGCAGGAGG + Intronic
1064028163 10:11865978-11866000 CAGCCGGAGAGCAGGACAGGTGG - Intronic
1064477337 10:15705374-15705396 CTGCTGGATTGGATGGCAGGAGG - Intronic
1065177682 10:23095408-23095430 CAGGTGGGAAGGAGGGAAGGAGG + Intergenic
1065844537 10:29734747-29734769 CATCTGAACAGGAGAGGAGGAGG - Intronic
1065890397 10:30116466-30116488 CAGCAGGACAAGCGGCCAGGAGG + Intergenic
1067063228 10:43088947-43088969 CGGCAGGACGGGAGGGCTGGGGG - Intronic
1067079644 10:43205803-43205825 GAGCTGGACAGGGCTGCAGGAGG - Intronic
1067665144 10:48271195-48271217 CAGAAGGACAGGAGGCAAGGGGG - Intronic
1067714086 10:48673110-48673132 CAGCTGGCCAGCAGGGAAGGTGG - Intergenic
1068393967 10:56437124-56437146 CAGAAGGACAGAAGGGTAGGAGG + Intergenic
1069565126 10:69458917-69458939 CCTCCGGGCAGGAGGGCAGGTGG - Intronic
1069718163 10:70533964-70533986 CAGCTGAAGACGAGGGCTGGGGG - Exonic
1069910172 10:71754145-71754167 ACGCTGGGCAGCAGGGCAGGGGG - Intronic
1070055939 10:72934686-72934708 CTGCTGCACAGAAGGGCTGGGGG - Intergenic
1071430374 10:85602245-85602267 AGGGTGGGCAGGAGGGCAGGCGG + Exonic
1071508529 10:86247111-86247133 CAGATGGACAAGTGGGCAAGGGG + Intronic
1072190383 10:93073019-93073041 CAGCTGGACAGCAGGGAAGGGGG - Intergenic
1072349800 10:94545727-94545749 CAGCGGGGCGGGAGGGCGGGTGG + Intronic
1072383766 10:94902281-94902303 CAGATGGTCAGGAGGGCATCTGG - Intergenic
1072615933 10:97048916-97048938 TAGGTGGACAGGTGGGCAGGTGG + Intronic
1072615936 10:97048924-97048946 CAGGTGGGCAGGTGGGCAGGCGG + Intronic
1072727164 10:97821842-97821864 GAGCAGGAAAGGGGGGCAGGAGG + Intergenic
1072736778 10:97884376-97884398 CAGCAGCAGAGGAGAGCAGGAGG + Intronic
1073100583 10:101004282-101004304 CAACTGGTGGGGAGGGCAGGGGG - Intronic
1073442324 10:103559437-103559459 CTGCTGGACGGCAGGGCAGTTGG + Intronic
1074707372 10:116146760-116146782 CTGCTGGACAGAAGGGAACGTGG + Intronic
1074857400 10:117483574-117483596 CAGAGGGACAGGAGGGCCTGAGG + Intergenic
1075132425 10:119751463-119751485 AAGCTGGAGAGGCAGGCAGGTGG + Intronic
1075324375 10:121519005-121519027 CTGGTGGAGAGAAGGGCAGGAGG + Intronic
1075536591 10:123276757-123276779 CTCCTGGCCAGGAGGGCAAGGGG + Intergenic
1075704858 10:124494547-124494569 CAGGTGGGCAGGAGGGGACGAGG + Intronic
1075911160 10:126126868-126126890 CTTCTGGACAAGAGGTCAGGTGG + Intronic
1075932809 10:126313675-126313697 TAGGTGGATAGAAGGGCAGGTGG - Intronic
1075962849 10:126584393-126584415 CAGGTGGACAGACAGGCAGGTGG - Intronic
1076001607 10:126917494-126917516 CAGCTGGACAGGAGTGGATCTGG - Intronic
1076393628 10:130122018-130122040 CAGGAGGGCAGGAGAGCAGGGGG - Intergenic
1076908251 10:133373701-133373723 CAGGCGGGCAGGCGGGCAGGCGG - Intergenic
1076908254 10:133373709-133373731 CAGGCGGGCAGGCGGGCAGGCGG - Intergenic
1076908257 10:133373717-133373739 CAGGCGGGCAGGCGGGCAGGCGG - Intergenic
1076908260 10:133373725-133373747 CAGGCGGGCAGGCGGGCAGGCGG - Intergenic
1076908263 10:133373733-133373755 CAGGCGGGCAGGCGGGCAGGCGG - Intergenic
1077015927 11:399254-399276 CAGGTGGGGAGGAAGGCAGGGGG - Intronic
1077066563 11:643679-643701 CTCTTGGTCAGGAGGGCAGGGGG + Intergenic
1077077297 11:707442-707464 CAGCAGGGCAGGAGGGTAGAGGG - Intronic
1077185774 11:1234750-1234772 CAGCGGGCAGGGAGGGCAGGGGG + Intronic
1077186684 11:1238621-1238643 CAGATGGACAGGTGGGCAGATGG + Intronic
1077186687 11:1238629-1238651 CAGGTGGGCAGATGGGCAGGTGG + Intronic
1077279748 11:1737949-1737971 CGGATGGAGCGGAGGGCAGGAGG + Intronic
1077292511 11:1804439-1804461 AAGCTGGAAAGGAGGAGAGGTGG - Intergenic
1077350350 11:2090370-2090392 CAGGTGGCCAGCAGGACAGGGGG - Intergenic
1077486086 11:2839009-2839031 TAGGTGGGCAGGTGGGCAGGTGG + Intronic
1077486089 11:2839017-2839039 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1077553710 11:3215849-3215871 CAGCAGGACAGGAAGGCGGCTGG - Intergenic
1078084297 11:8224562-8224584 CAGGTGGGCAGGCGGGCAGATGG + Exonic
1078163219 11:8859840-8859862 CATGTGGACAGGAAGTCAGGTGG - Intronic
1078218232 11:9329747-9329769 GTGCTGGACAGGAGTCCAGGTGG + Intergenic
1078599991 11:12721821-12721843 CTGCTGGACAGTGGGGCGGGGGG - Intronic
1078758103 11:14230562-14230584 CGGCTGGGAAGGTGGGCAGGGGG - Intronic
1078864310 11:15282340-15282362 AAGTTGGACAGGGTGGCAGGAGG + Intergenic
1079660912 11:23035563-23035585 CAGCAGGACGGAAGGGGAGGTGG - Intergenic
1079923313 11:26459133-26459155 CAGCTGGATTGGAGGGCATGAGG + Intronic
1079953268 11:26830878-26830900 CAGCTTGACAGGCAGCCAGGGGG - Intergenic
1079964394 11:26963197-26963219 AAGGAGGAAAGGAGGGCAGGAGG + Intergenic
1080397456 11:31903085-31903107 CAGCAGGGGAAGAGGGCAGGAGG + Intronic
1080765907 11:35296591-35296613 AAGTTGGAGAGGTGGGCAGGAGG - Intronic
1081150706 11:39627293-39627315 CAGCTGGAAAGCAGGGCACATGG + Intergenic
1081390416 11:42522793-42522815 CAGCAGAAAAGAAGGGCAGGAGG - Intergenic
1081540490 11:44031239-44031261 CTGCTGGAAGGGATGGCAGGGGG - Intergenic
1082930496 11:58598958-58598980 CAGCTGAACAGGAGGGAAGGGGG - Intronic
1083301784 11:61743506-61743528 CAGAGGGAGAGGAGAGCAGGGGG - Intronic
1083338914 11:61946090-61946112 TAGCTGGACAGGGGTGCTGGGGG - Intergenic
1083475949 11:62915711-62915733 CAGCTGGGGATGAGGGCAGCAGG - Intronic
1083697181 11:64450592-64450614 CTGGTGGTCAGGAGGGGAGGTGG - Exonic
1083754200 11:64781072-64781094 TAGCTGGGCATGATGGCAGGTGG - Intergenic
1084115871 11:67042730-67042752 CAGGAGGTCAGGAGGCCAGGTGG + Intronic
1084238197 11:67801640-67801662 CACTTGGAAAGGAGGGCAGAGGG + Intergenic
1084264829 11:67999490-67999512 CTGGTGGGCAGCAGGGCAGGAGG - Intronic
1084413048 11:69014992-69015014 CAGTGGGGCAGCAGGGCAGGGGG + Intergenic
1084424415 11:69076811-69076833 CACGAGGGCAGGAGGGCAGGTGG - Intronic
1084424434 11:69076877-69076899 CAGGAGGGCAGGAGGGCAAGTGG - Intronic
1084424475 11:69077010-69077032 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1084424493 11:69077068-69077090 CAGGAGGGCAGGAGGGCAAGTGG - Intronic
1084424503 11:69077101-69077123 CAGGAGGGCAGGAGGGCAAGTGG - Intronic
1084424552 11:69077259-69077281 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1084424584 11:69077367-69077389 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1084456769 11:69272393-69272415 CAGTGGGACAGGTGGGCAGATGG - Intergenic
1084469586 11:69349150-69349172 CAGCTGCTCAGGAAGGCAGCAGG - Intronic
1084487985 11:69462250-69462272 CAGCTGGCTGGGAGGGCAGAGGG + Intergenic
1084514780 11:69630856-69630878 CTGCTGGAAAGGAGGTCATGGGG + Intergenic
1084574700 11:69981660-69981682 TAGCGGGAGAGGAGGGCTGGAGG - Intergenic
1084834213 11:71791194-71791216 CACTTGGAAAGGAGGGCAGAGGG - Intronic
1084961089 11:72717067-72717089 TGGGTGGACAGGTGGGCAGGTGG + Intronic
1085386750 11:76162073-76162095 CAGCTGGACAGGGGGGCCAGAGG - Intergenic
1085533453 11:77204760-77204782 CAGCTGGGGAGGAAGGCGGGGGG - Intronic
1085733350 11:79018047-79018069 AAGCTGGGGAGGAGGGCTGGGGG + Intronic
1088994641 11:114985853-114985875 CAGGTGCCCAGGAGGGCAGGAGG + Intergenic
1089002745 11:115065798-115065820 GATCTGTACAGGAGGGCAGTTGG - Intergenic
1089297921 11:117481008-117481030 ACTCTGGGCAGGAGGGCAGGTGG + Intronic
1089313290 11:117574056-117574078 GAGCTGGATGGGAGGGAAGGGGG + Intronic
1089381597 11:118036668-118036690 CAGCTGGCCATGGGGGCAGAGGG + Intergenic
1089455897 11:118625591-118625613 CAGCTGCACAGGGGGGCAGGAGG + Intronic
1089665079 11:120013300-120013322 CTCCTGGACATGAGGGTAGGTGG + Intergenic
1089834441 11:121357637-121357659 CAGGTGGTCGGGAGGGCAGGTGG + Intergenic
1090640594 11:128726200-128726222 CAGCTTCAGGGGAGGGCAGGGGG - Intronic
1090844967 11:130522729-130522751 CAGCTGGACAGATGGGCCAGAGG - Intergenic
1090913996 11:131146444-131146466 GAGGGGGACATGAGGGCAGGAGG - Intergenic
1091437165 12:481703-481725 CAGCTGGGCTGGATGGCTGGGGG + Intronic
1091618336 12:2066852-2066874 GAGCTGGAAAGGAGGACAGGAGG + Intronic
1091685132 12:2556191-2556213 AGGCTGGAGAAGAGGGCAGGAGG - Intronic
1091788076 12:3255138-3255160 CAGCTGAGCAGGAGGGCTGATGG + Intronic
1092255428 12:6924552-6924574 GAGCTGGGCAGGATGGCAGAGGG - Intronic
1093149304 12:15602703-15602725 CAGCAGGACAGCAGAGCAGAGGG + Intergenic
1093152022 12:15633034-15633056 AGGCAGGACAGGAGGGAAGGAGG + Intronic
1094221617 12:28000041-28000063 CAGCTGGTCAGAGGGGCAGAAGG - Intergenic
1094318029 12:29153493-29153515 CAGTTGGAGAGGGGAGCAGGTGG + Intronic
1095752762 12:45729585-45729607 CAGGGGGAGAGGAGGGAAGGAGG - Intergenic
1095968493 12:47885008-47885030 AAGGTGGAAAGGAGGACAGGTGG + Intronic
1096109566 12:49020832-49020854 CATCTGGACATGGGGGCAGGAGG - Exonic
1096261286 12:50093594-50093616 CAGCTGCTCAGGAGGCGAGGTGG - Intronic
1096472042 12:51885047-51885069 CACCTGGACAGGAGAGGAGAAGG - Intergenic
1096677401 12:53232944-53232966 AGGCTGGAGAGGAGGGCAGGAGG + Intronic
1096812390 12:54179701-54179723 CAGTTGGTCAGAAGTGCAGGTGG - Intronic
1096940266 12:55336466-55336488 CAGCAGCACAGTAAGGCAGGTGG - Intergenic
1097181037 12:57172023-57172045 CAGCTGGAGTAGAGTGCAGGGGG - Intronic
1098237750 12:68434219-68434241 CACCTGAAAAGGAGGGGAGGAGG + Intergenic
1098912253 12:76221254-76221276 GGGATGGACTGGAGGGCAGGAGG + Intergenic
1099890488 12:88583549-88583571 CAGGTGGACAGGAGGGATGGGGG + Intergenic
1099935237 12:89117572-89117594 CAGCAGGGCAGCAGGGCAGCAGG - Intergenic
1100334705 12:93618485-93618507 CAGCTGGTCAGAGAGGCAGGTGG - Intergenic
1101421953 12:104557575-104557597 CGGCTGGACAGGAATCCAGGTGG + Intronic
1102573063 12:113839268-113839290 GGTCTGGCCAGGAGGGCAGGAGG + Intronic
1103525457 12:121564945-121564967 CAGCTGGATAGGAGAGTAGCTGG + Intronic
1104035381 12:125093728-125093750 CATCTCAGCAGGAGGGCAGGTGG - Intronic
1104821805 12:131681756-131681778 CAGCAGGATAGAAGGGCATGTGG - Intergenic
1104877284 12:132044328-132044350 CAGGGGGGCAAGAGGGCAGGAGG - Intronic
1104990288 12:132620662-132620684 CAGCTGGTCAGGAGGGAGGAGGG - Intronic
1105036020 12:132921791-132921813 CAGCTGGAGAGAAGGCCTGGTGG + Exonic
1105546029 13:21351847-21351869 CATCTGGAGAGGATGGCTGGTGG + Intergenic
1106430738 13:29678059-29678081 CGGCTGGCCAGGAGAGCAGGGGG - Intergenic
1106838711 13:33663739-33663761 CAAGTGGACAGCAGAGCAGGAGG + Intergenic
1107332552 13:39317327-39317349 CAGTTGGTCAGAAGTGCAGGAGG + Intergenic
1108205299 13:48082880-48082902 CAGCAGGGCAGGAAGGCATGTGG + Intronic
1108878079 13:55073135-55073157 CAGAGGGAAAGGAGAGCAGGAGG + Intergenic
1109452849 13:62540821-62540843 CTGGTGGCCAGGAGGGCAGGTGG - Intergenic
1110563093 13:76930175-76930197 CAGCTGGAGAGTAAGGGAGGGGG - Intergenic
1112391192 13:98985800-98985822 GCGCTGGTGAGGAGGGCAGGGGG + Intronic
1113069523 13:106406927-106406949 GAGCAGGACAGGAGGGAGGGAGG - Intergenic
1113425749 13:110207106-110207128 GAGCTGGGCTGGGGGGCAGGAGG - Intronic
1113618205 13:111695795-111695817 CAGTGGGGCAGGATGGCAGGAGG - Intergenic
1113623736 13:111781056-111781078 CAGTGGGGCAGGATGGCAGGAGG - Intergenic
1113660712 13:112104940-112104962 CAGCGGGACGCGAGGGCGGGAGG + Intergenic
1113732999 13:112655935-112655957 CAGGTGGACAGGAGGTGAGAGGG + Intronic
1113792586 13:113037046-113037068 GAGATGGACAGGAGGGCCGCTGG - Intronic
1113929044 13:113956843-113956865 CAGGGCGAGAGGAGGGCAGGTGG + Intergenic
1113936339 13:113996982-113997004 CAGCTGGAGATGTGGCCAGGTGG + Intronic
1113938225 13:114006141-114006163 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938260 13:114006251-114006273 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938321 13:114006437-114006459 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938381 13:114006623-114006645 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938429 13:114006771-114006793 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938464 13:114006881-114006903 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938499 13:114006991-114007013 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938534 13:114007103-114007125 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938630 13:114007380-114007402 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1113938653 13:114007452-114007474 CAGCAGGGCAGGAGGGGAGAAGG - Intronic
1115286353 14:31717244-31717266 CAGCAAGACAGGAAAGCAGGAGG - Intronic
1116186246 14:41604900-41604922 CAGCTGGAAAGGGTGGCAAGTGG + Intergenic
1116596170 14:46848590-46848612 AAGCTGCACAGGGAGGCAGGAGG - Intronic
1117525582 14:56599235-56599257 CAGAGGGACAGGAGGGCAAAAGG - Intronic
1117949402 14:61066424-61066446 CTGATGGCCAGGTGGGCAGGTGG + Intronic
1118148331 14:63164297-63164319 CAGTTGGACAGGGTTGCAGGAGG - Intergenic
1118225027 14:63890571-63890593 GAGGGAGACAGGAGGGCAGGTGG + Intronic
1118349275 14:64961823-64961845 CACCTGGACCTGAGGCCAGGAGG + Intronic
1118438697 14:65793505-65793527 AAGATGCACATGAGGGCAGGTGG + Intergenic
1118748467 14:68790425-68790447 CTGCTGGACAGAAAGGCAGTGGG - Exonic
1119003629 14:70905497-70905519 CAGCAGGCCAGGAAGGCAGCCGG - Intergenic
1119522484 14:75296162-75296184 CTGCAGGACGGGAGGGCAGTTGG - Intergenic
1119758759 14:77137047-77137069 CATCTGCACAGGAGGACAGGTGG - Intronic
1120969060 14:90192287-90192309 CAGCGGGAGTGGGGGGCAGGAGG + Intergenic
1121120475 14:91372804-91372826 CAGGTGGCCAGAAAGGCAGGTGG + Intronic
1121217778 14:92262149-92262171 CAGCTAGTCAGGAGGGTAAGGGG - Intergenic
1121620049 14:95340274-95340296 CCCCTGCACAGGAGGGGAGGAGG - Intergenic
1121816570 14:96933426-96933448 CAGCTGGGGAGGAAGGCAGTGGG + Intergenic
1122027476 14:98888260-98888282 CAGCTTGAGAGCAGGACAGGTGG + Intergenic
1122196158 14:100087499-100087521 CAGCTACTCAGGAGGCCAGGTGG + Intronic
1122323557 14:100869307-100869329 CAGCTGGGGTGGTGGGCAGGGGG + Intergenic
1122323744 14:100870349-100870371 CAGCTGGGGTGGTGGGCAGGGGG + Intergenic
1122355349 14:101119876-101119898 GAGCAGGACAGGAAAGCAGGAGG - Intergenic
1122631758 14:103110476-103110498 AAGCTGGACAGTCGGGCGGGAGG - Intronic
1122682882 14:103479752-103479774 CAGCTACTCAGGAGGCCAGGAGG - Intronic
1122805645 14:104255240-104255262 AAATTGGACAGGAGGGAAGGGGG - Intergenic
1122970501 14:105150291-105150313 CCTCGGGACTGGAGGGCAGGGGG - Intronic
1202884040 14_KI270722v1_random:87527-87549 CAACTGGACAGTGTGGCAGGAGG - Intergenic
1123677322 15:22723526-22723548 CAGCTGTACTGGGGGGCAGGGGG - Intergenic
1123821658 15:24036508-24036530 CAGCTGTACAGAAGGGTAAGAGG - Intergenic
1124329534 15:28797795-28797817 CAGCTCTACTGGGGGGCAGGGGG - Intergenic
1124604552 15:31160854-31160876 CAGCTGGGCGGAAGGGCAGAGGG - Intronic
1125681219 15:41531401-41531423 AAGGTGGGCAGGTGGGCAGGTGG - Intronic
1125742100 15:41972467-41972489 CAGCTGGATGGGGCGGCAGGCGG - Exonic
1126424018 15:48506075-48506097 CAGCTGGGCATGATGGCATGCGG + Intronic
1127277427 15:57459644-57459666 CACCTGCACAGGAGGTGAGGAGG + Intronic
1127898317 15:63321911-63321933 GAGGGAGACAGGAGGGCAGGAGG - Exonic
1128185508 15:65640589-65640611 CAGTTGGGCAGGAGGGCTGAGGG + Intronic
1128380312 15:67107465-67107487 CAGGAGGGCAGGAGGGCAGGAGG - Intronic
1128551533 15:68600904-68600926 CAGCAGGACAGCCGGGAAGGTGG - Intronic
1128610000 15:69065667-69065689 CAGCTGGAAAACAGGGGAGGGGG + Intergenic
1129331726 15:74831328-74831350 CAGCTTCACAGGAGGGGAGAAGG + Exonic
1129718048 15:77863189-77863211 CAGCTTGGCAGCAGGGCGGGAGG - Intergenic
1129823086 15:78617775-78617797 CAGCTGGCCAGGCTGGCAGAAGG + Intronic
1129852492 15:78801716-78801738 CACCCAGACAGGAGTGCAGGTGG + Intronic
1130550079 15:84884766-84884788 CAGTAGGAGAGGAGGGAAGGCGG + Intronic
1130884913 15:88084698-88084720 CTACTGGGCTGGAGGGCAGGGGG - Intronic
1131260019 15:90883290-90883312 GGGCTGGCCACGAGGGCAGGGGG - Exonic
1131403803 15:92147179-92147201 CAGGTGGAAAGGAGGAGAGGCGG - Intronic
1131488231 15:92839926-92839948 CAGCTGGAGAGCTCGGCAGGAGG - Intergenic
1132022225 15:98372582-98372604 CACCAGGACTGGAGGGCAAGTGG - Intergenic
1132091369 15:98950275-98950297 CAGGTGGACAGGAGGGAATGAGG + Intronic
1132202419 15:99964119-99964141 CTGGTGGCCAGGAGGGGAGGTGG - Intergenic
1132377996 15:101344511-101344533 CAGCAGGAGAGGAGGGAGGGAGG - Intronic
1132506900 16:314837-314859 CAGAGGGACAAGAGGACAGGTGG - Intronic
1132510311 16:337644-337666 CAGCTGGCTAGGTGGCCAGGTGG - Intronic
1132590114 16:722910-722932 CACCTGGGCAGGTGGGCAGAGGG - Exonic
1132626554 16:894259-894281 CAGGTGGACAGGGGGACAGGTGG - Intronic
1132626588 16:894354-894376 CAGGTGGACGGGGGGACAGGTGG - Intronic
1132686774 16:1165545-1165567 CAGATGCACCGGAGGCCAGGTGG - Intronic
1132745623 16:1435009-1435031 CAGCAGGGCAGGCGGGGAGGCGG + Intronic
1133113394 16:3562989-3563011 CAGGTGGATACCAGGGCAGGGGG - Exonic
1133282849 16:4676968-4676990 CTGCAGGACAGGATGGCAGGCGG - Intronic
1133349843 16:5094087-5094109 CACTTGGAAAGGAGGGCAGAGGG + Intronic
1134037562 16:11042402-11042424 GAGAGGGACAGGAGGACAGGAGG + Intronic
1134375536 16:13669339-13669361 AAGGTGGTCAGGAGGGCAGATGG + Intergenic
1134771454 16:16812792-16812814 CAGCTGAACAGGAGGGACAGTGG + Intergenic
1135041770 16:19122875-19122897 CAGGTGGAGAGGAGGGGAGGAGG + Intronic
1135973308 16:27088015-27088037 CACCTGGACAGGCAGGCAGCAGG - Intergenic
1135973625 16:27090267-27090289 CTGCTGGGCAGGAGGTCAGGGGG - Intergenic
1136011621 16:27367252-27367274 GGGCTGGACCAGAGGGCAGGAGG + Intergenic
1136142224 16:28294782-28294804 CAGCTGGAGACGAGGGTAGGGGG + Intronic
1136497239 16:30651789-30651811 CGGCTGGCCAGGCGGGCTGGAGG - Exonic
1136608379 16:31351874-31351896 CAGCAGGGCAGCAGGTCAGGGGG - Intergenic
1136777233 16:32878525-32878547 AACCTGGAGAGGTGGGCAGGGGG + Intergenic
1137351661 16:47718747-47718769 CAGCTGTGCAAGAAGGCAGGAGG + Intergenic
1137742243 16:50790366-50790388 CAGCAGGGGAGGAGGGCTGGTGG - Intronic
1138448204 16:57077848-57077870 CTGCGGGAGAGGAGGCCAGGTGG - Intronic
1138599636 16:58046938-58046960 CAGCTGGAAGGGCGTGCAGGTGG + Intergenic
1139323023 16:66130604-66130626 CTCCTGGACAGGAAGGAAGGAGG - Intergenic
1139510713 16:67427022-67427044 CAGCTGGACATGTGGGCCTGTGG + Intergenic
1139660341 16:68416450-68416472 ATTCTGGACAGGAGGGTAGGAGG - Intronic
1139952203 16:70677938-70677960 GCGCTGGGCAGGCGGGCAGGTGG - Intronic
1139964587 16:70738351-70738373 CGGCAGGACAGGAGCGCCGGAGG + Intronic
1140043673 16:71425827-71425849 GAGCGCGGCAGGAGGGCAGGAGG - Intergenic
1140230440 16:73113165-73113187 GAGCAGGAGAGGAGGGCAAGAGG + Intergenic
1140277366 16:73522665-73522687 CAGCTTGACAGTAAGGGAGGTGG - Intergenic
1140768324 16:78180510-78180532 CAGCTGCACAGGAGAGTAAGGGG + Intronic
1140768372 16:78180752-78180774 CAGCTGTACACGAGAGTAGGGGG + Intronic
1140967744 16:79983499-79983521 CAGCTACACAGGAGGGCTGAGGG + Intergenic
1141513985 16:84530869-84530891 CAGCTTGACAGAAATGCAGGTGG + Intronic
1141607174 16:85160709-85160731 CAGCTGCTCTGGAAGGCAGGGGG + Intergenic
1141612798 16:85192682-85192704 AAGCTGGCGAGGAGGCCAGGAGG - Intergenic
1141645695 16:85366250-85366272 CAGCTGCTCCGGAGGGCACGGGG + Intergenic
1141921583 16:87139136-87139158 CAGCTGGAGTGCAGGGCATGGGG - Intronic
1142028839 16:87828520-87828542 CAGCTGGGCTGGGGGCCAGGCGG + Intergenic
1142078790 16:88136139-88136161 CAGCTGGACAGCAGTGCCAGAGG + Intergenic
1142280702 16:89146209-89146231 CAGGTAGAGACGAGGGCAGGGGG + Intronic
1142350032 16:89575664-89575686 CGGCGGGAAATGAGGGCAGGGGG - Intergenic
1142690670 17:1604726-1604748 CAGCAGGAGGTGAGGGCAGGGGG - Intronic
1142849543 17:2697726-2697748 GAGCCTGACAGCAGGGCAGGTGG + Intronic
1142958115 17:3535048-3535070 CAGAGGGGCAGGAGGGGAGGAGG - Intronic
1142968356 17:3594930-3594952 CAGTGGGACAGGAAGACAGGAGG + Intronic
1142995797 17:3759560-3759582 GGGATGGGCAGGAGGGCAGGAGG + Intronic
1143090265 17:4445838-4445860 CCCCTGGGCAGGGGGGCAGGTGG + Intronic
1144092667 17:11871962-11871984 CAGGTGGCCTGGAGGGCAGTGGG - Intronic
1144147380 17:12411667-12411689 CAGAGGGACAGGGGGGCATGTGG - Intergenic
1144378263 17:14667186-14667208 CAGGTGGACTGGAGGGAACGAGG + Intergenic
1144580693 17:16457441-16457463 CAGCAAGACCAGAGGGCAGGAGG + Intronic
1144645667 17:16971979-16972001 CAGGAGGGCAGGAGGGCAGGTGG - Intronic
1144645671 17:16971987-16972009 TAGCCGGGCAGGAGGGCAGGAGG - Intronic
1144650911 17:17006182-17006204 CAGCTGGACATGGTGGCATGTGG + Intergenic
1144787654 17:17840765-17840787 CAGGGGGGCAGGGGGGCAGGGGG - Intergenic
1144807227 17:17976106-17976128 CAGCAGGGCAGAAGGACAGGAGG + Intronic
1144872065 17:18377820-18377842 AAGGAGGGCAGGAGGGCAGGTGG - Exonic
1145056675 17:19707742-19707764 CACCTGGAGACGTGGGCAGGTGG - Exonic
1145203783 17:20969593-20969615 TAGCCAGGCAGGAGGGCAGGTGG + Intergenic
1145273829 17:21418495-21418517 CAGCTGCTAAGGAGGGGAGGAGG - Exonic
1145747061 17:27328238-27328260 TAGCGGGGCAGCAGGGCAGGGGG + Intergenic
1145747627 17:27332144-27332166 CAGCTGGACAGGAGGAGATCTGG - Intergenic
1146187184 17:30731719-30731741 CAGGAGGAGAGGAGGGAAGGAGG - Intergenic
1146289926 17:31599547-31599569 CAGGAGCACAGGAGGGCAGTGGG + Intergenic
1146392081 17:32431848-32431870 CAGCTGCACAGGAAGCCATGTGG + Intergenic
1146537703 17:33667287-33667309 CAGCAGTATGGGAGGGCAGGAGG + Intronic
1146728631 17:35175400-35175422 CAGCCAGACTGGAGGGGAGGTGG + Intronic
1147644809 17:42027305-42027327 CCTCTGGACAGGAAGACAGGTGG - Intronic
1147645953 17:42034008-42034030 CAGCTGGGCAGAAGGGGAAGGGG + Intronic
1147685260 17:42283366-42283388 CAGCCAGTCAGGTGGGCAGGAGG - Intergenic
1148070134 17:44903918-44903940 CATCAGGAAAGCAGGGCAGGGGG - Exonic
1148159866 17:45443757-45443779 CACCTGGTTAGGTGGGCAGGAGG + Intronic
1148618430 17:49016795-49016817 CAGGAGGACAGGGGGGCGGGCGG - Intronic
1148714661 17:49707623-49707645 CAGCCGGGCAGGAGGACAAGAGG + Intronic
1148921060 17:51034607-51034629 AAACTGGACTGGAGGGAAGGAGG + Intronic
1148997475 17:51723801-51723823 CAGATGGAAAAGAGGGCAGAGGG - Intronic
1149451176 17:56751256-56751278 GAGCTGGCCTGGAGGGCAGGAGG - Intergenic
1150229703 17:63543373-63543395 CAGCTGGGCACCAGGACAGGAGG + Intronic
1150285302 17:63950694-63950716 GAGCTGGACAGTGGGGAAGGGGG + Intronic
1150295524 17:64005415-64005437 CAGCTCCACTGGAGGGCAGGGGG - Intronic
1150391152 17:64790631-64790653 CACCTGGTTAGGTGGGCAGGAGG + Intergenic
1150409936 17:64934681-64934703 CACCTGGTTAGGTGGGCAGGAGG + Intergenic
1151697884 17:75727384-75727406 CATCTGGCCAGAAGGACAGGGGG - Exonic
1152080592 17:78185021-78185043 CCACTGGACAGGACTGCAGGGGG + Intronic
1152494052 17:80658489-80658511 CAGCTGGACAGGGGGGTGCGGGG - Intronic
1152746154 17:82040248-82040270 AAGCTGGGCAAGAGGGCAGAGGG - Intergenic
1152784272 17:82239910-82239932 CTGCTGGCCACGAGGGCAGGTGG - Exonic
1152849252 17:82622576-82622598 TAGCTGGACATGGTGGCAGGTGG - Intronic
1153827697 18:8891603-8891625 CAGTTGGTCAGGAGTGAAGGTGG + Intergenic
1154197814 18:12279227-12279249 CAGCAGGAGAGGAGGTGAGGAGG + Intergenic
1155284158 18:24271707-24271729 CGGCTCGACTGGAGGGGAGGAGG - Intronic
1155336492 18:24770387-24770409 AAGGGGGCCAGGAGGGCAGGTGG - Intergenic
1156260932 18:35444532-35444554 GAGCTGGACAGAAGGAGAGGTGG + Intronic
1158971190 18:62668073-62668095 AAACTTGACAGGAGGCCAGGAGG - Intergenic
1159771230 18:72547344-72547366 CAGAAGGGCAGGAGGGTAGGAGG + Intronic
1160210444 18:76873943-76873965 GAGGAGGACAGGCGGGCAGGAGG - Intronic
1160210474 18:76874085-76874107 GAGGAGGACAGGCGGGCAGGAGG - Intronic
1160396425 18:78575694-78575716 CAGCTGGGCTAGAGGGGAGGGGG - Intergenic
1160481450 18:79244247-79244269 TAGGTGCACAGGAGGGCAGGGGG - Intronic
1160692329 19:465782-465804 TAGCTGGACAGATGGGTAGGTGG + Intronic
1160717136 19:581597-581619 CATGTGGGCAGGAGGGCAGACGG - Intronic
1160752550 19:741354-741376 CAGCTGGGCTGGAGGGCTGAGGG + Intronic
1160807266 19:997615-997637 CACCTGGGCTGGAGTGCAGGGGG - Intronic
1160969730 19:1762256-1762278 CAGGAGGGCAGGAGGGCAGGAGG - Intronic
1160969733 19:1762264-1762286 GAGGAGGGCAGGAGGGCAGGAGG - Intronic
1161164392 19:2778344-2778366 GAACTGGACAGGGTGGCAGGTGG + Intronic
1161344167 19:3759767-3759789 CTGCTGAGCAGGAGGGCAGCAGG - Exonic
1161355852 19:3819288-3819310 GTGCTGGGCAGGCGGGCAGGTGG + Intronic
1161410333 19:4113418-4113440 CAGATGGACAGGAGGGGAGGGGG + Intronic
1161431205 19:4233377-4233399 CCGCAGGACTGGAGGACAGGTGG - Intronic
1161573898 19:5045129-5045151 CAGTGGGACAGGTGGGCGGGAGG - Intronic
1162352231 19:10157834-10157856 CCGCTGCACAGGTGGGCTGGAGG + Intronic
1162464099 19:10830389-10830411 CAGTTGGGGTGGAGGGCAGGGGG - Intronic
1162562636 19:11426408-11426430 CAGCTGGGCAGGATGGCCGAGGG + Intronic
1162824400 19:13242871-13242893 CAGCTGGTAGGGAGGGCTGGGGG + Intronic
1162824430 19:13243035-13243057 CAGCTCCCCAGAAGGGCAGGTGG - Intronic
1162907234 19:13831163-13831185 CGGCTGGAGATGGGGGCAGGGGG + Exonic
1163061271 19:14763924-14763946 CAGGAGGAGAGGAGGGGAGGAGG - Intronic
1163823670 19:19510918-19510940 CACCTTGAGAGGAGGGCATGGGG + Intergenic
1163843266 19:19624534-19624556 CTGCTGGACACCAGGCCAGGTGG - Exonic
1164742205 19:30584145-30584167 ATGATGGATAGGAGGGCAGGAGG - Intronic
1164785700 19:30928681-30928703 CAGCTGAACAGAAGGACAGGAGG - Intergenic
1164965709 19:32480950-32480972 CACCTAGACCGGAGGGCAGGAGG - Intronic
1165940788 19:39413750-39413772 CAGCTGGAGCGGAGGGCGAGGGG - Intronic
1165985901 19:39768672-39768694 CAGTTGGTCAGAAGTGCAGGTGG - Intergenic
1165994293 19:39833415-39833437 AAGCGGGACAGGAGGCCCGGTGG + Exonic
1166269738 19:41706810-41706832 CTGGTGGACAGGAGGGAAGTGGG - Intronic
1166529693 19:43535006-43535028 CTGGGGGACAGGAGGGCTGGTGG - Intronic
1166550388 19:43662087-43662109 CAGGTGGAGAAGAGGGCAGCAGG - Intronic
1166881350 19:45932182-45932204 TAGCTGGACATGGTGGCAGGTGG - Intergenic
1167435215 19:49475062-49475084 GAGATGGACAGGAGGGAAGATGG + Intronic
1167571351 19:50290867-50290889 CAGCTGGAGAGGAGGTCAGGAGG - Exonic
1167598207 19:50438331-50438353 CAGATAGACAGGTGGGAAGGTGG + Intronic
1168414187 19:56158567-56158589 CAGGTGGAAAGGAGGACAGTGGG + Exonic
924959781 2:23920-23942 AACCTGGGCAGGAGAGCAGGTGG - Intergenic
925222596 2:2154003-2154025 CCTCTGGACCGGATGGCAGGAGG + Intronic
925447754 2:3942653-3942675 CAGGTGGGCAGGTGGGCAAGTGG + Intergenic
925501759 2:4512747-4512769 CAGCTGGAATGGAGTGAAGGAGG - Intergenic
925881302 2:8355029-8355051 CACATGGGCAGAAGGGCAGGAGG + Intergenic
926217840 2:10916006-10916028 CAGCTGGGAAAGAGGGGAGGAGG + Intergenic
926797093 2:16627965-16627987 CAGCTGGGCGGGCAGGCAGGCGG + Intronic
926841734 2:17088690-17088712 CAGCTGGAGAGGTGGGCAAGGGG + Intergenic
927435215 2:23060737-23060759 CAGCTGGAGAGGTGGGTTGGAGG - Intergenic
927646434 2:24879888-24879910 CATCTGGGCAGGTGGGAAGGAGG + Intronic
927653788 2:24928655-24928677 CAGCAGTACTGGAGGGGAGGCGG + Intergenic
927692006 2:25215233-25215255 GTGCTGGGGAGGAGGGCAGGCGG - Intergenic
927934295 2:27067137-27067159 CAGCTGCTCAGGAGGCTAGGTGG + Intronic
928424439 2:31166544-31166566 AGGCTGGCCAGGAGGGCATGAGG + Intergenic
928434864 2:31248461-31248483 GTGCAGGACAGGAGGCCAGGAGG - Intronic
929149316 2:38733489-38733511 CAGCAGCACAGGAGGGAAGCGGG - Exonic
929564383 2:42975450-42975472 AAGCAGGACTGGAGGGCTGGAGG - Intergenic
930114640 2:47708064-47708086 AAGCTGGAGAGGTGGGCAGGAGG + Intronic
930722018 2:54647039-54647061 CAGCTGCTCAGCAGGGTAGGAGG - Intronic
931020730 2:58041911-58041933 CAGCTTGAAAGGGGGGTAGGAGG - Intronic
931687432 2:64806460-64806482 CAGCTGGTGAGCAGGGCAGCTGG - Intergenic
932347320 2:71004204-71004226 CAGGTGGAGAGGTGGGCAAGTGG - Intergenic
932570438 2:72935714-72935736 GAGCTGGGCAGGGGGGTAGGGGG - Intronic
932707697 2:74039357-74039379 TATCTGGGCAGGTGGGCAGGTGG - Intronic
933699853 2:85246844-85246866 CAAGTGGACAAGAGGGAAGGAGG - Intronic
933709624 2:85315783-85315805 CAGCTGGAGGGGAAGGTAGGGGG + Intergenic
933713440 2:85343991-85344013 CAGCTGGAGGGGAAGGTAGGGGG - Exonic
935046882 2:99490322-99490344 GAGCAGGACGGGCGGGCAGGCGG - Intergenic
935071402 2:99697265-99697287 CAGCTGGGCAGCACGGCAGGTGG + Intronic
935550397 2:104446983-104447005 CAGCTGTAAAGGAGGGGAGGGGG + Intergenic
935686734 2:105690170-105690192 CGTATGGACAGGTGGGCAGGTGG + Intergenic
936229444 2:110687263-110687285 CAGTTGGTCAGAAGTGCAGGTGG - Intergenic
936363831 2:111832814-111832836 CAGCTATTCAGGAGGCCAGGAGG + Intronic
936376766 2:111947704-111947726 CAGGTAGACGGGAAGGCAGGTGG + Intronic
936471581 2:112803241-112803263 AAGCTGGACAGGTGGGATGGTGG + Intergenic
937037567 2:118794486-118794508 AAGCTGGACAGGACTGCTGGAGG - Intergenic
937124654 2:119465912-119465934 GAGCTAGCCAGGAGGGCCGGCGG - Intronic
937307632 2:120881856-120881878 CATGTGGGAAGGAGGGCAGGTGG + Intronic
937340350 2:121087108-121087130 CAGATGGACAGATGGACAGGAGG - Intergenic
937395303 2:121530026-121530048 CAGCTGGAAGGGAAGGCAGCGGG + Intronic
937499220 2:122460477-122460499 CAGCTGAACAAGAGGTCAGATGG - Intergenic
937896097 2:126977662-126977684 CAGCAGCAAAGGAAGGCAGGAGG - Intergenic
938240262 2:129737918-129737940 CAGGAGGGCAGGAGAGCAGGAGG - Intergenic
938240266 2:129737934-129737956 CAGGAGGGCAGGAGGGCAGGAGG - Intergenic
938421922 2:131153280-131153302 CAGCACCACAGGAGGGGAGGAGG - Intronic
938507959 2:131906604-131906626 CAGCTACTCAGGAGGTCAGGAGG + Intergenic
938600882 2:132837938-132837960 CAGCTGGACAGAAGAGGTGGAGG + Intronic
938791625 2:134681341-134681363 GAGCTGGAGAAGAGGGTAGGAGG - Intronic
941185613 2:162318489-162318511 CACCTGGGCAGGTGGGCAGGCGG + Exonic
941185617 2:162318497-162318519 CAGGTGGGCAGGCGGGCAGGTGG + Exonic
943439945 2:187916127-187916149 CAGTTGGACAGGGTTGCAGGAGG + Intergenic
943727013 2:191262287-191262309 CAGCTGGGGAGGAGGGGGGGCGG - Intronic
944147223 2:196518781-196518803 CAGGTGGGCAAGAGGGCAGCAGG - Intronic
944618430 2:201486037-201486059 CAGATGGAAAGGACAGCAGGAGG - Intergenic
945971440 2:216235330-216235352 CAGCTGGTCAGCAGCACAGGTGG + Intergenic
946027486 2:216680539-216680561 AACCTGGGCAGGATGGCAGGTGG + Intronic
946999236 2:225434235-225434257 CTGCTGTACTGGAGGGCAGAGGG - Intronic
947514009 2:230785380-230785402 CAGGGGGGCAGGGGGGCAGGGGG + Intronic
947805092 2:232961007-232961029 GAGCTGGGCAGCACGGCAGGAGG - Intronic
947811875 2:233009874-233009896 CAGGTGGAGTGGAGGGAAGGTGG - Intronic
947911680 2:233804754-233804776 CAGGTGGCCAGGAGGGCAGCAGG + Intronic
947934521 2:233992579-233992601 CAGCTGAGCAGGAGAGGAGGAGG - Intronic
948211275 2:236195055-236195077 CATCTGGAAGGGAAGGCAGGTGG + Exonic
948466311 2:238153389-238153411 CAGCTGGACAACAGGGGTGGTGG - Intergenic
948486252 2:238283131-238283153 TTGCTGGACAGGAGGCAAGGAGG + Intronic
948756464 2:240162310-240162332 CTGCTGGTCTGGAGGGCATGGGG + Intergenic
948992780 2:241563232-241563254 CAGCTGGACAAGTGGACAGCGGG - Intronic
1168974172 20:1951759-1951781 GAGCTGGGCAGGAGGCGAGGTGG - Intergenic
1169084671 20:2819324-2819346 CAGCTGGGCAGGAGGGTAAAAGG - Intronic
1169122534 20:3105963-3105985 CAGCGGGGGAGGAAGGCAGGTGG + Intergenic
1169123208 20:3109770-3109792 CTGCTGGACAGGGGGGTATGCGG + Exonic
1169391706 20:5196250-5196272 CAGAAGGACAGGAGGGCTCGGGG - Exonic
1170188296 20:13617549-13617571 CAGCTCTACTGGGGGGCAGGGGG + Intronic
1172181774 20:33008054-33008076 CACCTGGCCAGGAGGGGATGAGG + Intronic
1173018250 20:39245996-39246018 CATCTGGTCAGGCTGGCAGGAGG + Intergenic
1173470562 20:43320371-43320393 CAACCAGACAGAAGGGCAGGAGG - Intergenic
1174118078 20:48241639-48241661 CAGGAGGACAACAGGGCAGGAGG - Intergenic
1174275512 20:49400994-49401016 CAGGTGGATAGGTGGGTAGGTGG - Intronic
1174275515 20:49401002-49401024 CAGATGGACAGGTGGATAGGTGG - Intronic
1174535472 20:51248052-51248074 CTGCTGGGCAGAAAGGCAGGTGG + Intergenic
1174816449 20:53691344-53691366 TAGCTGGACATGATGGCAGGAGG + Intergenic
1175277736 20:57783423-57783445 CAGCTGGACAGAAAGCCAGAGGG + Intergenic
1175451783 20:59075753-59075775 CAGAGAGACAGGAGGCCAGGTGG + Intergenic
1175540940 20:59747213-59747235 CAGATGGACAGGAAGGGAGGAGG - Intronic
1175786095 20:61712570-61712592 AAGCTGGAGAGAAGGGGAGGAGG - Intronic
1175852287 20:62100069-62100091 CAGCAGGACAGCAGGGCCGTGGG - Intergenic
1175942807 20:62545754-62545776 CAGCTGGACAGCTGGGCTGTGGG - Intergenic
1175997534 20:62818260-62818282 GAGCTGGGCAGGGGGGCAGAGGG - Intronic
1176026087 20:62986349-62986371 CAGGTGGACTGGGGTGCAGGTGG + Intergenic
1176032725 20:63021504-63021526 CTGTAGGACAGGAGGGAAGGAGG - Intergenic
1176077616 20:63255365-63255387 CAGCGGGAGATCAGGGCAGGTGG + Intronic
1176093387 20:63328817-63328839 AAGGAGGACAGGAGGGCGGGAGG - Intronic
1176163175 20:63658856-63658878 CAGCCAGCCAGGAGGGCAGAGGG + Intronic
1176304136 21:5114546-5114568 GACCTGGACAGGAGGTGAGGAGG + Intergenic
1176785524 21:13251960-13251982 CAGCTACTCAGGAGGTCAGGAGG - Intergenic
1177926742 21:27226362-27226384 CAGCTGGGCAAGAGAGCAGAGGG - Intergenic
1177983564 21:27945670-27945692 CAGCTACTCAGGAGGTCAGGAGG - Intergenic
1178580267 21:33832150-33832172 CAGCAAGGCAGGAGAGCAGGGGG - Intronic
1179564725 21:42240095-42240117 AGGCAGGAGAGGAGGGCAGGTGG + Intronic
1179577560 21:42317449-42317471 CAGCAGGTCATGAGGGCCGGAGG - Intergenic
1179714303 21:43279882-43279904 CAGGTGGAGGGGAGGGGAGGTGG + Intergenic
1179731341 21:43369423-43369445 GACCTGGGCGGGAGGGCAGGGGG + Intergenic
1179852920 21:44147484-44147506 GACCTGGACAGGAGGTGAGGAGG - Intergenic
1179913637 21:44462863-44462885 CAGGTGGTCAGGAGGACAGCAGG - Intergenic
1180326927 22:11438222-11438244 CAACTGGACAGTGTGGCAGGAGG - Intergenic
1180935378 22:19622036-19622058 CCGCGGCAGAGGAGGGCAGGCGG - Intergenic
1181323319 22:22025476-22025498 CCAGTGGCCAGGAGGGCAGGAGG - Intergenic
1181487479 22:23240832-23240854 GTGCTGGACAGGAGGGGAGGAGG - Intronic
1181615177 22:24049436-24049458 CAGCAGGAGAGGCGGGCAGCAGG - Intronic
1181725171 22:24806353-24806375 CCGCTGGACACGAGGGCGGCGGG + Intronic
1182044574 22:27264219-27264241 CTGGTGGAAAGGAAGGCAGGTGG + Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1182275936 22:29188653-29188675 CAGCTGCCCAGGAGGCCAGTGGG + Intergenic
1182669537 22:31984200-31984222 CAGCTAGGGAGAAGGGCAGGAGG + Intergenic
1183358042 22:37369844-37369866 CACCAGGAAAAGAGGGCAGGGGG - Exonic
1183360921 22:37383086-37383108 CAGCTGTACCCAAGGGCAGGAGG - Intronic
1183430646 22:37763487-37763509 CTGCTGGAGAGGCGGGGAGGTGG + Intronic
1183512892 22:38246142-38246164 CACAGGGACGGGAGGGCAGGTGG + Intronic
1183538007 22:38414246-38414268 CAGATGGACGGGAGGGTGGGAGG - Intergenic
1183566214 22:38617023-38617045 GTGCTGGGGAGGAGGGCAGGTGG + Intronic
1183780866 22:39998090-39998112 CAGCTGGACAGGCTGGCGTGGGG - Intronic
1183976574 22:41515747-41515769 CACCTGGACAGGAGGGGGCGAGG - Exonic
1184308337 22:43624424-43624446 GAGGAGGCCAGGAGGGCAGGAGG - Intronic
1184317119 22:43703091-43703113 CAGTTGGACAGGGTTGCAGGAGG - Intronic
1184816981 22:46879982-46880004 GTTGTGGACAGGAGGGCAGGTGG + Intronic
1184836834 22:47028979-47029001 CAGCTGGGCAGAGGTGCAGGTGG - Intronic
1184839391 22:47043668-47043690 CAGCTGAACAGGAGGGTGGAAGG + Intronic
1184900767 22:47445181-47445203 CAGGAGGACAGGAGGATAGGTGG - Intergenic
1184900769 22:47445189-47445211 CAGGTGAACAGGAGGACAGGAGG - Intergenic
1184900775 22:47445213-47445235 CAGGTGGACAGGCAGACAGGAGG - Intergenic
1184900778 22:47445229-47445251 CAGGTGGACAGGAGGACAGGTGG - Intergenic
1184900782 22:47445245-47445267 CAGGTGGACAGGAAAACAGGTGG - Intergenic
1184900807 22:47445358-47445380 CAGGAGGACAGGTGGACAGGTGG - Intergenic
1184900809 22:47445366-47445388 CAGGTGAACAGGAGGACAGGTGG - Intergenic
1184900829 22:47445475-47445497 TAGGTGGACAGAAGGACAGGCGG - Intergenic
1184900837 22:47445515-47445537 CAGGTGGACAGGCAGACAGGAGG - Intergenic
1184900840 22:47445531-47445553 CAGGTGGACAGGAGGACAGGTGG - Intergenic
1184900844 22:47445547-47445569 CAGGTGGACAGGAAAACAGGTGG - Intergenic
1184900847 22:47445563-47445585 CAGGAGGACAGGCGGACAGGTGG - Intergenic
1184900849 22:47445571-47445593 CAAGTAGACAGGAGGACAGGCGG - Intergenic
1184900858 22:47445627-47445649 CAGGAGGACAGGAGGTCAGGAGG - Intergenic
1184920851 22:47604771-47604793 ATGATGGACAGGAGGGCAGCAGG + Intergenic
1185042772 22:48513913-48513935 CAGCTACCCAGCAGGGCAGGAGG + Intronic
1185042778 22:48513921-48513943 CAGCAGGGCAGGAGGAAAGGGGG + Intronic
1185058605 22:48593817-48593839 CAGCAGGGCAGGAGGGCGGCAGG - Intronic
1185229352 22:49671166-49671188 CAGATGAAAAGGAAGGCAGGTGG + Intergenic
949585336 3:5431529-5431551 CAGCTGGACAGGAGAAAACGGGG - Intergenic
949801942 3:7913929-7913951 CAGCTGGGCAGAAGTGCAGAGGG + Intergenic
950113548 3:10435643-10435665 CAGGGTGACAGGTGGGCAGGAGG + Intronic
950259425 3:11533216-11533238 GAGCTGGAGAGGAGGGCTTGGGG - Intronic
950263994 3:11561531-11561553 CAGCTGGGGAGGAGGGGTGGTGG - Intronic
950622218 3:14215131-14215153 CAGCTGGAGAAGAGGGAGGGTGG - Intergenic
951670866 3:25180556-25180578 TAGGTGGACATGAGGTCAGGTGG + Intronic
952925265 3:38315459-38315481 CTGCTGGCCAGCTGGGCAGGTGG + Intronic
953431387 3:42843578-42843600 CTGCTAGACAGCAGGGGAGGAGG - Intronic
953448582 3:42988137-42988159 CAGCTGGGCTGGAGGCCAGAAGG - Intronic
953535794 3:43775727-43775749 CAGCTGGCCTGGTGGGGAGGTGG + Intergenic
953878035 3:46677377-46677399 CAGCTGTAAGGGAGGGCAGAGGG - Intronic
954197843 3:49006965-49006987 CAGCAGGACAGAAGGACAGCCGG - Exonic
954331050 3:49890454-49890476 CATGTGGACTGTAGGGCAGGTGG + Intronic
954619024 3:51985335-51985357 GAGATGGTCAGGAGGGTAGGTGG - Intronic
954806690 3:53224737-53224759 CAGACGGTCAGGAGGACAGGTGG + Intronic
955060482 3:55488331-55488353 CAGTTGGCCAGAAGGGCTGGGGG - Intronic
955523794 3:59800813-59800835 CAACAGGACAGGAGTGCAGGAGG + Intronic
955776312 3:62437521-62437543 CAGCTGGCTGGGTGGGCAGGGGG + Intronic
958542435 3:95496165-95496187 CAGCAGGAGAGGAGGGTGGGTGG - Intergenic
958876282 3:99621409-99621431 GAGGTGGTCAGGAAGGCAGGTGG - Intergenic
961002933 3:123386167-123386189 TAGGTGGACAGGAGGGCACAGGG + Intronic
961123920 3:124398876-124398898 CAGGGGGCCAGGAGGGGAGGTGG + Intronic
961300694 3:125920276-125920298 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
961368813 3:126417520-126417542 CAGTTGGAGAGGCAGGCAGGGGG + Intronic
962006682 3:131356762-131356784 AAGCAGGACAGAAAGGCAGGAGG + Intergenic
962285670 3:134084095-134084117 CAGCTTCCCAGGAGGCCAGGAGG - Intronic
962367920 3:134797974-134797996 CAGCTAGGCAGGCGGGAAGGCGG - Intronic
962369042 3:134805535-134805557 CTGCTGGGCAGGAGGGCAGGAGG - Intronic
962382695 3:134910277-134910299 CAGCAGAGTAGGAGGGCAGGAGG + Intronic
962382781 3:134910860-134910882 CAACTGCACAGGAGGTCAAGGGG - Intronic
962681036 3:137800677-137800699 AGGCTGGAAAGGTGGGCAGGAGG + Intergenic
963247349 3:143075232-143075254 CAGCTGGACTGGGGGCCAGTAGG + Intergenic
966855868 3:184193517-184193539 CTGAAAGACAGGAGGGCAGGAGG - Intronic
966886494 3:184380283-184380305 CAGCTGGGGAGGAGGGAGGGAGG - Exonic
966912391 3:184566708-184566730 CAGCGGGGCAGGAGGGCAGGGGG - Intronic
967127697 3:186439899-186439921 CAGTGGGACAGGAGGGGAGGCGG - Intergenic
967788117 3:193519356-193519378 GAGTTGGAGAGGAAGGCAGGTGG - Intronic
967920058 3:194607841-194607863 CAGCTGGACAGTGGGGCTCGGGG + Intronic
968081120 3:195847602-195847624 AGGCTGGAAAGGAGGGAAGGGGG - Intergenic
968084772 3:195869391-195869413 CGGCTGGGCCGGAGGGGAGGTGG - Intronic
968173798 3:196531333-196531355 CAGGCGGGCAGGCGGGCAGGCGG - Intergenic
968423419 4:504368-504390 GAGCTGGAAAGGAGGGAAGTGGG + Intronic
968492424 4:897199-897221 CAGATTCACAGGAGAGCAGGGGG + Intronic
968565625 4:1311083-1311105 CGGCTGGAGAGGAGGCGAGGTGG + Intronic
968569052 4:1329795-1329817 AGGCTGGACAAGAGGGAAGGCGG + Intronic
968812036 4:2804530-2804552 CAGCAGGACAGGAAGGCCTGGGG - Intronic
968943428 4:3651311-3651333 CACCTGGAAAGGTGGGCAGCAGG - Intergenic
968996943 4:3951744-3951766 CACATGGAAAGGAGGGCAGAGGG + Intergenic
969343653 4:6557975-6557997 CCTGTGGACAGGAAGGCAGGAGG + Intronic
969593777 4:8136780-8136802 CAGCTGGACCCGAGGCCACGTGG - Intronic
969659535 4:8518406-8518428 CAGCTGGGCATTAGGGCAGAAGG + Intergenic
969757062 4:9156936-9156958 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
970046145 4:11856873-11856895 CTGCTGCAGTGGAGGGCAGGAGG - Intergenic
971267850 4:25110736-25110758 CAGCTGGCCTGCAGGGCAGTGGG - Intergenic
971320100 4:25598763-25598785 CAGCTACTCAGGAGGCCAGGAGG - Intergenic
972750137 4:41980404-41980426 CAGCTGGGCTGGAGTGCAGTGGG + Intergenic
973816390 4:54623263-54623285 CAGGGGGCCAGGAAGGCAGGAGG - Intergenic
974103601 4:57443420-57443442 CAGGCTGACAAGAGGGCAGGGGG - Intergenic
974262179 4:59540209-59540231 CACCCGGGCAGGAGGACAGGAGG + Intergenic
977124465 4:93147649-93147671 CAGCAGAACAGAAGGGGAGGTGG + Intronic
977433258 4:96958871-96958893 CCTCTGGACAGGAGTGCAGGAGG + Intergenic
982071835 4:151702342-151702364 CAGCTGGAGAAGAGGGAGGGAGG + Intronic
982220318 4:153119124-153119146 CAGCTGGACAGGAGGGGAGAGGG - Intergenic
983204783 4:164901187-164901209 CAGCTAGTCAGGAAGGCAGATGG - Intergenic
983547099 4:168976056-168976078 CAGCTGAACATGTTGGCAGGTGG - Intronic
984717272 4:182937499-182937521 CTGCAGGACACGAGGGCAGGAGG - Intergenic
984936995 4:184898219-184898241 CAGCAGGACAGGAAGGCTGTGGG + Intergenic
985117692 4:186607516-186607538 TAGATGGACAGGTGGGTAGGTGG + Intronic
985469460 5:29930-29952 AACCTGGGCAGGAGAGCAGGTGG - Intergenic
985663624 5:1169855-1169877 CAGCAGGGAAGGAGGGGAGGAGG + Intergenic
986661039 5:10060501-10060523 AAGCTGGATAGAAGGGCACGTGG - Intergenic
986788671 5:11139591-11139613 CAGCTGGCCAGCAGGACACGAGG - Intronic
987110836 5:14684930-14684952 CACCTGGGCAGGATGACAGGAGG - Intronic
988498460 5:31764481-31764503 AATGTGTACAGGAGGGCAGGAGG - Intronic
988507782 5:31838983-31839005 CAGATGATCTGGAGGGCAGGAGG - Intronic
990329157 5:54708222-54708244 CACGATGACAGGAGGGCAGGTGG - Intergenic
991329964 5:65483214-65483236 GAACTGGACCGGAGGGAAGGGGG + Intergenic
991404006 5:66284079-66284101 CAGATTGAAAGGAGTGCAGGAGG + Intergenic
993065721 5:83095337-83095359 CAGTTGGACAGGGTTGCAGGAGG + Intronic
994049589 5:95347323-95347345 CAGGGGGAAAGGAGGCCAGGTGG + Intergenic
994052320 5:95376641-95376663 CCTCTTGACAGGATGGCAGGAGG + Intergenic
994166555 5:96615319-96615341 CAGCTGTACAGGATGGCATTTGG + Intronic
996394571 5:123000522-123000544 CAGCTGGACAGTAGAGGAAGAGG - Intronic
996416422 5:123215739-123215761 CAGCTGGTCATAAGTGCAGGTGG - Intergenic
997240229 5:132301398-132301420 CAGCTGCAGAAGAGGACAGGAGG - Intronic
997470779 5:134115611-134115633 CACCTGGGCAGGAGGGGAGGCGG - Intronic
997658070 5:135569892-135569914 CAGGTGGACAGGTGGACAGTAGG - Intergenic
998108189 5:139481736-139481758 CAGAAGGGCAGGAGGGCAAGGGG - Intronic
998148582 5:139744489-139744511 CAGCTCTACAGGCGAGCAGGCGG - Intergenic
999255351 5:150206897-150206919 CAGCAGGGCAGCAGGGCAGCGGG - Intronic
999397412 5:151238717-151238739 CATCTGGACCAGAAGGCAGGGGG + Intronic
999663427 5:153889158-153889180 TAACAGGAAAGGAGGGCAGGGGG + Intergenic
1000241546 5:159413094-159413116 CTGCTGGCAAGGATGGCAGGCGG - Intergenic
1001085783 5:168699222-168699244 CAGGTGGACACGTGGGCGGGCGG + Intronic
1001311039 5:170611175-170611197 CAGCTGGGCAGGAAGGAAGCAGG + Intronic
1001403900 5:171462350-171462372 CAGCTGGGCAGGCAGGCAGGAGG - Intergenic
1001445838 5:171782224-171782246 CAGAAGGACAGGAGGGAAGATGG + Intergenic
1001539416 5:172526894-172526916 CAGGTGAGCAGTAGGGCAGGTGG + Intergenic
1001571359 5:172732580-172732602 CAGCTGGAGAGCAGGGCTTGTGG - Intergenic
1001603268 5:172942977-172942999 CGGCTGGGAATGAGGGCAGGTGG + Intronic
1001706015 5:173741694-173741716 CAGGGGGACAGGGGGACAGGGGG + Intergenic
1001706019 5:173741702-173741724 CAGGGGGACAGGGGGACAGGGGG + Intergenic
1001706023 5:173741710-173741732 CAGGGGGACAGGGGGACAGGGGG + Intergenic
1001755857 5:174167841-174167863 CAGCCGGACAGGTGAGGAGGAGG + Intronic
1001771428 5:174300002-174300024 CAGCAGTAAAGGAGGGCAGCTGG + Intergenic
1002105233 5:176876708-176876730 GAGCAGGACGGGAGGGCAGTGGG + Intronic
1002424979 5:179169562-179169584 CAGATGCTCAGGAGGACAGGGGG + Intronic
1002450744 5:179317143-179317165 CAGAGTGACAGGAGGGCTGGAGG - Intronic
1002470214 5:179430500-179430522 GAGATGGGCAGGAGGGTAGGTGG + Intergenic
1003007084 6:2392203-2392225 ATGCAGGAAAGGAGGGCAGGAGG + Intergenic
1003405583 6:5824590-5824612 CATCTGGAGAGGATGGCTGGTGG - Intergenic
1003661444 6:8065756-8065778 CAGCTGGTCAGAAGTGCAGGTGG + Intronic
1004294079 6:14394580-14394602 TAGCATGAAAGGAGGGCAGGAGG - Intergenic
1004396192 6:15248355-15248377 CAGGCGGGCAGGAGGGCGGGTGG + Intronic
1004590507 6:17047033-17047055 AAGCTGGACAGGTAGGCAGGTGG + Intergenic
1004822541 6:19383241-19383263 CAGAGGGGCAGGGGGGCAGGAGG - Intergenic
1005563402 6:27064494-27064516 TAGCTGGCCAGGAGGGCTAGTGG + Intergenic
1005871036 6:29974689-29974711 CATCTGCACTGGAGGGGAGGGGG + Intergenic
1006058885 6:31404765-31404787 CATCTGCACTGGAGGGGAGGGGG - Intronic
1006071369 6:31499650-31499672 CACCTGCACTGGAGGGGAGGGGG - Intronic
1006379000 6:33687108-33687130 AGGCTGGGCAGGTGGGCAGGCGG + Intronic
1006652662 6:35564395-35564417 CAGCTGGAGGGGAAGGCAAGGGG + Intergenic
1006824821 6:36926973-36926995 CTGCTGGACAGAAGTGGAGGAGG + Intronic
1007837640 6:44686510-44686532 CAGTGGGAAAGGAGGGAAGGGGG - Intergenic
1007968637 6:46028259-46028281 CAGCTGGAAAGGAGCAGAGGAGG - Intronic
1011216908 6:85014786-85014808 CAGCTGAACAGGAGGGCAAGGGG + Intergenic
1011628623 6:89303124-89303146 CAGCTGGAGTGAGGGGCAGGTGG + Intronic
1014190806 6:118494564-118494586 AGGCGGGACAGGATGGCAGGAGG - Intronic
1014761521 6:125362683-125362705 CCCCTGGACTGGAGGGCAGGAGG + Intergenic
1016350842 6:143165540-143165562 CAGGTGGAGCGGAGGGCTGGTGG - Intronic
1017260366 6:152378738-152378760 GAGGTGGGAAGGAGGGCAGGGGG - Intronic
1017510775 6:155112804-155112826 CAGCAGGACTCGAGGGCAGGTGG - Intronic
1017700464 6:157064683-157064705 CAGCTGGTCAGGAGAGGATGTGG - Intronic
1017822434 6:158059377-158059399 CAGCTGGGCTGGGCGGCAGGTGG + Intronic
1018650415 6:165987820-165987842 CAGATGGAAAGGAGGGAAGGAGG - Intergenic
1018721266 6:166574310-166574332 CTGCTGGGGAGGAGGGAAGGAGG - Intronic
1018722246 6:166581742-166581764 CCGCTGGGCAGGAGGGCACGGGG + Intronic
1018722288 6:166581862-166581884 GGGCTGGGCAGGAGGGCACGGGG + Intronic
1019351610 7:556649-556671 CGGCTGGACAGGAGGGGCCGAGG + Intronic
1019398385 7:835972-835994 CTGCTGGACAGGCGGGAAGAAGG + Intronic
1019406148 7:885300-885322 CAGCAGGCGTGGAGGGCAGGAGG - Intronic
1019478495 7:1255398-1255420 CATGGGGACAGGAGGGGAGGGGG + Intergenic
1019595768 7:1857651-1857673 CAGCTGGACAGGAGGAAGAGGGG + Intronic
1019637881 7:2086100-2086122 CTGCTGGCCAGGAGGGAGGGAGG - Intronic
1019676196 7:2314154-2314176 CAGGCGCGCAGGAGGGCAGGGGG + Intronic
1020461768 7:8435404-8435426 CAGCTGGGGAGGCGGGCGGGCGG - Intronic
1020624475 7:10560594-10560616 CAACTCTACAGGAAGGCAGGAGG + Intergenic
1021360533 7:19707453-19707475 CCATTGGAGAGGAGGGCAGGGGG - Intronic
1021628160 7:22615122-22615144 CAACTGGACAGGAAGTAAGGTGG + Intronic
1022260020 7:28695210-28695232 GAGCTAGACAGGAGGGAGGGAGG + Intronic
1023522087 7:41059151-41059173 CAGCAGGAGAGTAGGGGAGGGGG - Intergenic
1024001884 7:45195155-45195177 CAGCAGGACAGGAGGGGCTGAGG + Intergenic
1024295620 7:47839647-47839669 CAGTTGGGCAGGAGCGCTGGAGG + Exonic
1024897290 7:54274928-54274950 CAGCTGGACAGGATTGCAAGAGG + Intergenic
1025085593 7:56020693-56020715 CTGCAGGGCGGGAGGGCAGGAGG + Intronic
1025142588 7:56478495-56478517 CAGCTGGGCTGTTGGGCAGGCGG + Intergenic
1026401794 7:70021413-70021435 AAGCTGGATGGGAGGGAAGGAGG + Intronic
1026631188 7:72039651-72039673 CAGCTGCACAGTGGGGAAGGAGG - Intronic
1026830567 7:73607551-73607573 CAGGTGGGCAGGTGGGCAGGCGG + Intronic
1026846719 7:73702809-73702831 GGGCTGGAGTGGAGGGCAGGGGG + Intronic
1027235542 7:76295557-76295579 CAGCTGGGCAGGGGGGCATGTGG + Intergenic
1027794391 7:82674285-82674307 CATGTGGATAGGATGGCAGGAGG + Intergenic
1028904105 7:96134146-96134168 CAGCTACTCAGGAGGCCAGGAGG - Intronic
1029221628 7:98995107-98995129 CAGGAAGGCAGGAGGGCAGGAGG - Intronic
1029225865 7:99028096-99028118 CATCTGGGCAGAGGGGCAGGGGG + Exonic
1029488462 7:100857269-100857291 CAGAGGGAATGGAGGGCAGGAGG + Intronic
1030320950 7:108166838-108166860 CAGCTGGAGATGGGGGCTGGTGG - Intronic
1030403191 7:109078551-109078573 CAGCTGCAAAGAGGGGCAGGGGG + Intergenic
1031150297 7:118046264-118046286 CAGGTGGGCAGGCAGGCAGGTGG - Intergenic
1032067165 7:128780232-128780254 CAGCTGGAGGGGAGGGGAGTGGG - Intergenic
1032083620 7:128872544-128872566 CAGACAGCCAGGAGGGCAGGGGG - Intronic
1032435661 7:131898355-131898377 CAGTTGTACAAGAGGGTAGGCGG + Intergenic
1032783327 7:135182054-135182076 CAGCAGGACATGTGGGCAGAGGG - Intergenic
1033296582 7:140143350-140143372 CATCTGAAAAGGATGGCAGGTGG + Intronic
1033686815 7:143647572-143647594 GAGCTGGACATCAGGACAGGGGG - Intronic
1033688919 7:143719735-143719757 GAGCTGGACATCAGGACAGGGGG + Exonic
1033845964 7:145432589-145432611 CAGCTGGATAGTAGGTCAGATGG - Intergenic
1034093659 7:148386771-148386793 CAGATTAACAGGTGGGCAGGGGG + Intronic
1034441725 7:151089042-151089064 CAGCAGGGCAGCAGGGCAGCAGG - Intronic
1034673820 7:152877187-152877209 CATCTACCCAGGAGGGCAGGTGG - Intergenic
1034989333 7:155538274-155538296 CAGATGGACTGCAGGGCTGGAGG - Intergenic
1035021665 7:155804230-155804252 CAGGCGGGCAGGCGGGCAGGCGG - Intronic
1035102995 7:156416622-156416644 CAGCTGGACAGAGAGGCTGGGGG - Intergenic
1035251392 7:157599849-157599871 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251397 7:157599865-157599887 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251402 7:157599881-157599903 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251412 7:157599911-157599933 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251417 7:157599927-157599949 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251422 7:157599943-157599965 CAGGTGGAGATGTGGGCAGGTGG - Intronic
1035251426 7:157599959-157599981 CAGGTGGAGAGGTAGGCAGGTGG - Intronic
1035251430 7:157599975-157599997 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251435 7:157599991-157600013 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251440 7:157600007-157600029 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251445 7:157600023-157600045 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251450 7:157600039-157600061 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251455 7:157600055-157600077 CAGGTGGAGAGGTAGGCAGGTGG - Intronic
1035251459 7:157600071-157600093 CAGGTGGAGATGTGGGCAGGTGG - Intronic
1035251468 7:157600101-157600123 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251473 7:157600117-157600139 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251478 7:157600133-157600155 CAGGTGGAGATGTGGGCAGGTGG - Intronic
1035251482 7:157600149-157600171 CAGGTGGAGAGGTAGGCAGGTGG - Intronic
1035251486 7:157600165-157600187 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251491 7:157600181-157600203 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251496 7:157600197-157600219 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251501 7:157600213-157600235 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251506 7:157600229-157600251 CAGGTGGAGAGGTAGGCAGGTGG - Intronic
1035251510 7:157600245-157600267 CAGGTGGAGATGTGGGCAGGTGG - Intronic
1035251514 7:157600261-157600283 CAGGTGGAGATGTGGGCAGGTGG - Intronic
1035325688 7:158064524-158064546 CAGCTGGACAGGAAACCATGGGG - Intronic
1035608701 8:946914-946936 CAGCAGGACAGGGCGGCCGGTGG - Intergenic
1036380292 8:8232251-8232273 CACTTGGAAAGGAGGGCAGAGGG - Intergenic
1036719125 8:11156405-11156427 CAGCTGAAGAGGCAGGCAGGTGG - Intronic
1036899190 8:12658869-12658891 CAGCTGGCCAAAAGGGGAGGGGG - Intergenic
1036962834 8:13264584-13264606 GAGCGGGAGAGGAGGGAAGGAGG + Intronic
1036989555 8:13577249-13577271 TAGCTGGACAGTAGGGAGGGAGG + Intergenic
1037056268 8:14445534-14445556 CAGCTGGAGAAGGGGGCAGGTGG - Intronic
1037139962 8:15507870-15507892 CAGATGGAAAGGAGTGAAGGTGG + Intronic
1037754596 8:21702802-21702824 CACCTGGACAGACGTGCAGGTGG + Exonic
1037883743 8:22585649-22585671 CAGCAGGATGGGAGGGGAGGGGG - Intronic
1038261860 8:26002851-26002873 CAGGCGGGCAGGCGGGCAGGCGG + Intronic
1038261863 8:26002859-26002881 CAGGCGGGCAGGCGGGCAGGCGG + Intronic
1038261866 8:26002867-26002889 CAGGCGGGCAGGCGGGCAGGCGG + Intronic
1038261876 8:26002895-26002917 CAGGCGGGCAGGCGGGCAGGCGG + Intronic
1038261879 8:26002903-26002925 CAGGCGGGCAGGCGGGCAGGCGG + Intronic
1039461449 8:37748845-37748867 CAGCTGGAAAGGAAGGTGGGGGG + Intronic
1040388568 8:46931336-46931358 CAGCTGCAGAGGCAGGCAGGCGG - Intergenic
1041399970 8:57432270-57432292 GGGCTGGCCAGGAGGGTAGGGGG - Intergenic
1041568787 8:59312167-59312189 AAGCTGTACAGTGGGGCAGGAGG - Intergenic
1041683619 8:60620822-60620844 CAGCTGAGCAGGAGGAGAGGGGG - Exonic
1041757520 8:61330636-61330658 CATCTGTACAGCAGGGCTGGTGG - Intronic
1041788621 8:61664747-61664769 GGGCTGGAGAGGAGGGAAGGTGG + Intronic
1042611892 8:70608628-70608650 TGGATGGCCAGGAGGGCAGGAGG - Exonic
1044544634 8:93445940-93445962 CAGCTGCAAAGGAAGGGAGGAGG - Intergenic
1045325142 8:101112362-101112384 CAGCAGGAGCGGAGGCCAGGAGG + Intergenic
1045508364 8:102794552-102794574 CAGCTGGAGAGGAGGAATGGTGG - Intergenic
1045526949 8:102949090-102949112 CAGCTGGAAAGGAGGGAATGTGG - Intronic
1047425205 8:124739084-124739106 CAGGGGGGCAGGGGGGCAGGGGG + Intergenic
1048205004 8:132408393-132408415 CAGCTGGATTGAAGGTCAGGGGG - Intronic
1048400615 8:134065435-134065457 CAACTGGTCAGCAGGACAGGGGG + Intergenic
1048591032 8:135820963-135820985 CAGCTGGATGGGAGGGCATCAGG - Intergenic
1049155332 8:141062717-141062739 TGGCTGGATAGGTGGGCAGGTGG + Intergenic
1049415621 8:142493537-142493559 CTTCAGGACAGGAGGACAGGAGG + Intronic
1049512509 8:143036325-143036347 CAGCTGGACGGGAGGGCAGCTGG + Intergenic
1049641772 8:143719193-143719215 TGGCTGGGCAGGAGGGCAGCAGG - Intronic
1049775203 8:144400836-144400858 CAGCAGGAGAGGAGGGGAGGCGG + Intronic
1049854897 8:144855255-144855277 CAGGGGGAGAGGAGGGCAGTAGG + Intergenic
1051019548 9:12525729-12525751 CTGGTGACCAGGAGGGCAGGTGG - Intergenic
1052714317 9:32097421-32097443 AAGCTCAACAGGTGGGCAGGAGG - Intergenic
1053576513 9:39360509-39360531 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1053841023 9:42188434-42188456 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1054098081 9:60919200-60919222 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1054119482 9:61194830-61194852 CAGCTGGACAGGAGGGCAGGTGG + Exonic
1054588272 9:66987732-66987754 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1054766234 9:69044767-69044789 CAGCTGGTCAGCAGAGCTGGTGG + Intronic
1054822504 9:69537544-69537566 CTTCTGGAAAGGAGGGAAGGAGG + Intronic
1055107174 9:72525274-72525296 AAGTAGGACAGGAGGGCAGCTGG + Intronic
1055829058 9:80358947-80358969 CAGGTGGACAGACAGGCAGGGGG + Intergenic
1055986303 9:82058926-82058948 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1056143693 9:83708322-83708344 CAGCTGGGCATGAGGTAAGGTGG - Intergenic
1056580859 9:87887336-87887358 CGACTGGACACAAGGGCAGGGGG + Exonic
1056585040 9:87922207-87922229 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1056611839 9:88130733-88130755 CAGCTGGACAGGAGGGCAGGTGG - Intergenic
1056655131 9:88502840-88502862 AAGATGGACAGGAGGGCAGCGGG + Intergenic
1056850894 9:90082640-90082662 CAGGGTGACAGGTGGGCAGGTGG + Intergenic
1057160869 9:92887257-92887279 CAGCTGGACAGGAGGGCAGGTGG + Intergenic
1057628862 9:96702734-96702756 CAGCTACTCAGGAGGCCAGGTGG + Intergenic
1057695804 9:97322254-97322276 GGGCTGGGGAGGAGGGCAGGGGG - Intronic
1058843608 9:108934254-108934276 CAGATGGGCAAGAGGGCAGAGGG - Exonic
1058951770 9:109910670-109910692 CAGCAGGGCATGAGGGCAGAGGG + Intronic
1059061283 9:111037844-111037866 GCGCGGGACAGGAGGGCCGGCGG + Exonic
1059658966 9:116382523-116382545 AAGCTGGAGAAGTGGGCAGGAGG - Intronic
1060585207 9:124781307-124781329 AGGCTGGGCAGGAGGGTAGGTGG + Intronic
1060806955 9:126583738-126583760 CAGCTGGGAAGAAGGGCAGACGG + Intergenic
1060815093 9:126631016-126631038 GAGCTGGAGGGGTGGGCAGGCGG - Intronic
1060864287 9:126982695-126982717 CAGGAGAACAGCAGGGCAGGGGG - Intronic
1061216770 9:129226177-129226199 CAGCTGGTGGGGTGGGCAGGGGG + Intergenic
1061266071 9:129505730-129505752 CTCCAGGAGAGGAGGGCAGGGGG - Intergenic
1061615053 9:131774009-131774031 CAGCTGGGCAGCCGGGCAGCCGG + Intergenic
1061780679 9:132994451-132994473 CTCCTGGACAGGAGGAGAGGTGG - Intergenic
1061995681 9:134181587-134181609 CAGCAGGACCCGTGGGCAGGTGG - Intergenic
1061999310 9:134207829-134207851 CAGCTGGAGAGGATGGGGGGAGG - Intergenic
1062126169 9:134864232-134864254 CAGCAGGACAGAAGGGCTTGTGG - Intergenic
1062186339 9:135220566-135220588 GAGCTGGAGGTGAGGGCAGGTGG + Intergenic
1062186342 9:135220582-135220604 CAGGTGGACAGCAGGGCTGCTGG + Intergenic
1062205130 9:135332099-135332121 CAGCTGGTGGGGAGGGCTGGTGG - Intergenic
1062245345 9:135563211-135563233 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062245348 9:135563219-135563241 CAGGTGGGCAGGTGGGTAGGTGG + Intronic
1062245366 9:135563283-135563305 CAGGTGGGTAGGTGGGCAGGTGG + Intronic
1062245375 9:135563331-135563353 CAGGTGGGCAGGTGAGCAGGTGG + Intronic
1062245381 9:135563355-135563377 TAGGTGAACAGGTGGGCAGGTGG + Intronic
1062245384 9:135563363-135563385 CAGGTGGGCAGGTGGGTAGGTGG + Intronic
1062245393 9:135563395-135563417 CAGGTGGACAGGTGGGTAGGTGG + Intronic
1062245420 9:135563499-135563521 TAGGTGAACAGGTGGGCAGGTGG + Intronic
1062245423 9:135563507-135563529 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062245426 9:135563515-135563537 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062245429 9:135563523-135563545 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062245431 9:135563531-135563553 CAGGTGGGCAGGTGGGCAAGTGG + Intronic
1062380732 9:136285428-136285450 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062380735 9:136285436-136285458 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062380738 9:136285444-136285466 CAGGTGGGCAGGTGGGCAGGCGG + Intronic
1062380741 9:136285452-136285474 CAGGTGGGCAGGCGGGCAGGTGG + Intronic
1062380744 9:136285460-136285482 CAGGCGGGCAGGTGGGCAGGTGG + Intronic
1062380747 9:136285468-136285490 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062380750 9:136285476-136285498 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062380753 9:136285484-136285506 CAGGTGGGCAGGTGGGCAGGTGG + Intronic
1062473199 9:136715114-136715136 CAGGTGGACAGGAGGCCACAGGG + Intronic
1062614865 9:137391662-137391684 CAGCTGGGCACCAGGGCCGGCGG - Intronic
1062721123 9:138044696-138044718 CAGGTGGACGGGAGGGCAGAGGG + Intronic
1185645209 X:1610838-1610860 CAGAGGGAGAGGAGGGGAGGGGG - Intergenic
1187479535 X:19642528-19642550 CAGCTGAACAGGTGGGTTGGGGG - Intronic
1188022053 X:25169927-25169949 GAGCTTGACAAGAGCGCAGGAGG - Intergenic
1188988105 X:36785952-36785974 CAGCTGGGCAAGAGGAGAGGTGG + Intergenic
1189353133 X:40292076-40292098 CAGCTAGGGAGAAGGGCAGGAGG + Intergenic
1189364812 X:40380313-40380335 CAGCTGGAGGGGAGGCAAGGTGG + Intergenic
1189543828 X:42021147-42021169 CAGCTGGGCAGAAGTGCAGGTGG - Intergenic
1190298475 X:49042456-49042478 CAGCTGGGTAGGCGGGCAGAGGG + Intronic
1190332502 X:49244526-49244548 GAGATGGACAGAAGGGGAGGAGG - Intronic
1190335190 X:49257766-49257788 CAGCTGGGCAGAAAGGCAGGTGG + Exonic
1190700936 X:52989544-52989566 CAGCTGCACAGCAGGTCAGTGGG + Intronic
1192420257 X:71023026-71023048 CAGAAGGACAGGAGGGGAGGAGG + Intergenic
1193032010 X:76908366-76908388 CTGCTGCACAGGAGGGCCTGAGG - Intergenic
1194828986 X:98597186-98597208 CAGCTGGAAAAAAGGGCAGAGGG + Intergenic
1196041648 X:111211224-111211246 GAACTGGAAAGGTGGGCAGGGGG + Intronic
1197775660 X:130117315-130117337 GAGCTGGACAGCAGCTCAGGAGG + Intergenic
1198243044 X:134803059-134803081 CAGCTGGCCAGTGGCGCAGGTGG + Intronic
1198677421 X:139145688-139145710 CAGTTGGAGAGGAGGGAAGGTGG - Intronic
1199622980 X:149715548-149715570 CAGCTGGACATCAGAGCAGGAGG - Intronic
1199767941 X:150954144-150954166 CAGGAGGGCAGGAGAGCAGGAGG - Intergenic
1199881422 X:151976421-151976443 GTGTTGGACAGGACGGCAGGCGG - Intergenic