ID: 1053598337

View in Genome Browser
Species Human (GRCh38)
Location 9:39585755-39585777
Sequence CTGCTGATGTTCAGGATAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053598337_1053598349 26 Left 1053598337 9:39585755-39585777 CCCTTTATCCTGAACATCAGCAG No data
Right 1053598349 9:39585804-39585826 CTGAGATCCAGGACCTATTGAGG No data
1053598337_1053598344 -3 Left 1053598337 9:39585755-39585777 CCCTTTATCCTGAACATCAGCAG No data
Right 1053598344 9:39585775-39585797 CAGGTGGGCCCAGGACTACCAGG No data
1053598337_1053598348 15 Left 1053598337 9:39585755-39585777 CCCTTTATCCTGAACATCAGCAG No data
Right 1053598348 9:39585793-39585815 CCAGGCAAATTCTGAGATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053598337 Original CRISPR CTGCTGATGTTCAGGATAAA GGG (reversed) Intergenic
No off target data available for this crispr