ID: 1053599355

View in Genome Browser
Species Human (GRCh38)
Location 9:39594320-39594342
Sequence CTGTTGGTATGGAGGACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053599349_1053599355 4 Left 1053599349 9:39594293-39594315 CCAAACAACCAAATCAGCTGTAA No data
Right 1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG No data
1053599350_1053599355 -4 Left 1053599350 9:39594301-39594323 CCAAATCAGCTGTAACTGCCTGT No data
Right 1053599355 9:39594320-39594342 CTGTTGGTATGGAGGACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053599355 Original CRISPR CTGTTGGTATGGAGGACAGA AGG Intergenic
No off target data available for this crispr