ID: 1053601923

View in Genome Browser
Species Human (GRCh38)
Location 9:39619621-39619643
Sequence CTGCAGATATTGAAAACAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053601916_1053601923 23 Left 1053601916 9:39619575-39619597 CCCTGCAGATCAAACAGTTGAGT No data
Right 1053601923 9:39619621-39619643 CTGCAGATATTGAAAACAGAAGG No data
1053601920_1053601923 -6 Left 1053601920 9:39619604-39619626 CCCATAGAAGAGGACACCTGCAG No data
Right 1053601923 9:39619621-39619643 CTGCAGATATTGAAAACAGAAGG No data
1053601917_1053601923 22 Left 1053601917 9:39619576-39619598 CCTGCAGATCAAACAGTTGAGTG No data
Right 1053601923 9:39619621-39619643 CTGCAGATATTGAAAACAGAAGG No data
1053601921_1053601923 -7 Left 1053601921 9:39619605-39619627 CCATAGAAGAGGACACCTGCAGA No data
Right 1053601923 9:39619621-39619643 CTGCAGATATTGAAAACAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053601923 Original CRISPR CTGCAGATATTGAAAACAGA AGG Intergenic
No off target data available for this crispr