ID: 1053603420

View in Genome Browser
Species Human (GRCh38)
Location 9:39632878-39632900
Sequence AGGGGAAATAAGAGGGATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053603420_1053603427 12 Left 1053603420 9:39632878-39632900 CCAGCATCCCTCTTATTTCCCCT No data
Right 1053603427 9:39632913-39632935 TTTTTTTTTTTTTTTTGAGACGG 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053603420 Original CRISPR AGGGGAAATAAGAGGGATGC TGG (reversed) Intergenic
No off target data available for this crispr