ID: 1053607301

View in Genome Browser
Species Human (GRCh38)
Location 9:39673387-39673409
Sequence GGTAGGCATGGAATCGTATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053607301_1053607308 10 Left 1053607301 9:39673387-39673409 CCTAATACGATTCCATGCCTACC No data
Right 1053607308 9:39673420-39673442 CAACTAGAGTAAGGAATATAAGG No data
1053607301_1053607307 1 Left 1053607301 9:39673387-39673409 CCTAATACGATTCCATGCCTACC No data
Right 1053607307 9:39673411-39673433 TTGGACTCACAACTAGAGTAAGG No data
1053607301_1053607309 18 Left 1053607301 9:39673387-39673409 CCTAATACGATTCCATGCCTACC No data
Right 1053607309 9:39673428-39673450 GTAAGGAATATAAGGAGCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053607301 Original CRISPR GGTAGGCATGGAATCGTATT AGG (reversed) Intergenic
No off target data available for this crispr