ID: 1053607307

View in Genome Browser
Species Human (GRCh38)
Location 9:39673411-39673433
Sequence TTGGACTCACAACTAGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053607301_1053607307 1 Left 1053607301 9:39673387-39673409 CCTAATACGATTCCATGCCTACC No data
Right 1053607307 9:39673411-39673433 TTGGACTCACAACTAGAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053607307 Original CRISPR TTGGACTCACAACTAGAGTA AGG Intergenic
No off target data available for this crispr