ID: 1053610482 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 9:39708470-39708492 |
| Sequence | TGTACACAGCTGAAAGTGCG CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1053610478_1053610482 | 26 | Left | 1053610478 | 9:39708421-39708443 | CCATACTGAAAGTGAAAAACAGA | 0: 16 1: 22 2: 18 3: 66 4: 409 |
||
| Right | 1053610482 | 9:39708470-39708492 | TGTACACAGCTGAAAGTGCGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1053610482 | Original CRISPR | TGTACACAGCTGAAAGTGCG CGG | Intergenic | ||
| No off target data available for this crispr | |||||