ID: 1053610482

View in Genome Browser
Species Human (GRCh38)
Location 9:39708470-39708492
Sequence TGTACACAGCTGAAAGTGCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053610478_1053610482 26 Left 1053610478 9:39708421-39708443 CCATACTGAAAGTGAAAAACAGA 0: 16
1: 22
2: 18
3: 66
4: 409
Right 1053610482 9:39708470-39708492 TGTACACAGCTGAAAGTGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053610482 Original CRISPR TGTACACAGCTGAAAGTGCG CGG Intergenic
No off target data available for this crispr