ID: 1053610613

View in Genome Browser
Species Human (GRCh38)
Location 9:39709710-39709732
Sequence GGGTGCCTTCTCATGAGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053610613_1053610616 1 Left 1053610613 9:39709710-39709732 CCAGATCTCATGAGAAGGCACCC No data
Right 1053610616 9:39709734-39709756 CTGTCATGAGAACAGCACCAAGG No data
1053610613_1053610618 7 Left 1053610613 9:39709710-39709732 CCAGATCTCATGAGAAGGCACCC No data
Right 1053610618 9:39709740-39709762 TGAGAACAGCACCAAGGGAATGG No data
1053610613_1053610617 2 Left 1053610613 9:39709710-39709732 CCAGATCTCATGAGAAGGCACCC No data
Right 1053610617 9:39709735-39709757 TGTCATGAGAACAGCACCAAGGG 0: 22
1: 146
2: 334
3: 744
4: 978

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053610613 Original CRISPR GGGTGCCTTCTCATGAGATC TGG (reversed) Intergenic
No off target data available for this crispr