ID: 1053610815

View in Genome Browser
Species Human (GRCh38)
Location 9:39711399-39711421
Sequence AGTTATTCACAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053610815_1053610818 4 Left 1053610815 9:39711399-39711421 CCTGCCATCTTCTGTGAATAACT No data
Right 1053610818 9:39711426-39711448 TCCTTTTGAGAAACAACTCTTGG 0: 6
1: 30
2: 252
3: 273
4: 455

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053610815 Original CRISPR AGTTATTCACAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr