ID: 1053613587

View in Genome Browser
Species Human (GRCh38)
Location 9:39741009-39741031
Sequence TAAGATATACACAAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053613578_1053613587 -9 Left 1053613578 9:39740995-39741017 CCATCCACTGCCCATAAGATATA No data
Right 1053613587 9:39741009-39741031 TAAGATATACACAAGGGGGAGGG No data
1053613577_1053613587 23 Left 1053613577 9:39740963-39740985 CCATCGCATTTCATTTGTTATTT No data
Right 1053613587 9:39741009-39741031 TAAGATATACACAAGGGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053613587 Original CRISPR TAAGATATACACAAGGGGGA GGG Intergenic
No off target data available for this crispr