ID: 1053616995

View in Genome Browser
Species Human (GRCh38)
Location 9:39778081-39778103
Sequence CTGCAGCAACAGAAGGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053616992_1053616995 0 Left 1053616992 9:39778058-39778080 CCTGATAACAAACTACTTCCAAA No data
Right 1053616995 9:39778081-39778103 CTGCAGCAACAGAAGGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053616995 Original CRISPR CTGCAGCAACAGAAGGAAAA TGG Intergenic
No off target data available for this crispr