ID: 1053619200

View in Genome Browser
Species Human (GRCh38)
Location 9:39798767-39798789
Sequence TGGCCCCCTTTGGACTGTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053619200_1053619210 26 Left 1053619200 9:39798767-39798789 CCTCCACAGTCCAAAGGGGGCCA No data
Right 1053619210 9:39798816-39798838 AAGCATGCACACATGCAGCTGGG No data
1053619200_1053619209 25 Left 1053619200 9:39798767-39798789 CCTCCACAGTCCAAAGGGGGCCA No data
Right 1053619209 9:39798815-39798837 CAAGCATGCACACATGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053619200 Original CRISPR TGGCCCCCTTTGGACTGTGG AGG (reversed) Intergenic
No off target data available for this crispr