ID: 1053619201

View in Genome Browser
Species Human (GRCh38)
Location 9:39798770-39798792
Sequence CCTTGGCCCCCTTTGGACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053619201_1053619210 23 Left 1053619201 9:39798770-39798792 CCACAGTCCAAAGGGGGCCAAGG No data
Right 1053619210 9:39798816-39798838 AAGCATGCACACATGCAGCTGGG No data
1053619201_1053619209 22 Left 1053619201 9:39798770-39798792 CCACAGTCCAAAGGGGGCCAAGG No data
Right 1053619209 9:39798815-39798837 CAAGCATGCACACATGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053619201 Original CRISPR CCTTGGCCCCCTTTGGACTG TGG (reversed) Intergenic
No off target data available for this crispr