ID: 1053619210

View in Genome Browser
Species Human (GRCh38)
Location 9:39798816-39798838
Sequence AAGCATGCACACATGCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053619200_1053619210 26 Left 1053619200 9:39798767-39798789 CCTCCACAGTCCAAAGGGGGCCA No data
Right 1053619210 9:39798816-39798838 AAGCATGCACACATGCAGCTGGG No data
1053619201_1053619210 23 Left 1053619201 9:39798770-39798792 CCACAGTCCAAAGGGGGCCAAGG No data
Right 1053619210 9:39798816-39798838 AAGCATGCACACATGCAGCTGGG No data
1053619206_1053619210 16 Left 1053619206 9:39798777-39798799 CCAAAGGGGGCCAAGGGGCTGGC No data
Right 1053619210 9:39798816-39798838 AAGCATGCACACATGCAGCTGGG No data
1053619207_1053619210 6 Left 1053619207 9:39798787-39798809 CCAAGGGGCTGGCATGTCAGCAC No data
Right 1053619210 9:39798816-39798838 AAGCATGCACACATGCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053619210 Original CRISPR AAGCATGCACACATGCAGCT GGG Intergenic
No off target data available for this crispr