ID: 1053619948

View in Genome Browser
Species Human (GRCh38)
Location 9:39804699-39804721
Sequence CATTCCAAACATGAATTTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053619947_1053619948 -7 Left 1053619947 9:39804683-39804705 CCAACAGGAATATAAGCATTCCA No data
Right 1053619948 9:39804699-39804721 CATTCCAAACATGAATTTTGTGG No data
1053619943_1053619948 23 Left 1053619943 9:39804653-39804675 CCATACTAGATGTACGGTTTTAT No data
Right 1053619948 9:39804699-39804721 CATTCCAAACATGAATTTTGTGG No data
1053619945_1053619948 -3 Left 1053619945 9:39804679-39804701 CCCACCAACAGGAATATAAGCAT No data
Right 1053619948 9:39804699-39804721 CATTCCAAACATGAATTTTGTGG No data
1053619946_1053619948 -4 Left 1053619946 9:39804680-39804702 CCACCAACAGGAATATAAGCATT No data
Right 1053619948 9:39804699-39804721 CATTCCAAACATGAATTTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053619948 Original CRISPR CATTCCAAACATGAATTTTG TGG Intergenic
No off target data available for this crispr