ID: 1053623835

View in Genome Browser
Species Human (GRCh38)
Location 9:39848041-39848063
Sequence TCATTAACAGGACAGTGTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053623835_1053623840 28 Left 1053623835 9:39848041-39848063 CCTTAACACTGTCCTGTTAATGA No data
Right 1053623840 9:39848092-39848114 CAAAATAAATGCATTAGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053623835 Original CRISPR TCATTAACAGGACAGTGTTA AGG (reversed) Intergenic
No off target data available for this crispr