ID: 1053633811

View in Genome Browser
Species Human (GRCh38)
Location 9:39974082-39974104
Sequence TCTTATGTAAGATTAACTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053633805_1053633811 20 Left 1053633805 9:39974039-39974061 CCAAACAAGCCCATTTTTCTTTT No data
Right 1053633811 9:39974082-39974104 TCTTATGTAAGATTAACTTATGG No data
1053633806_1053633811 11 Left 1053633806 9:39974048-39974070 CCCATTTTTCTTTTGTTAGCCAT No data
Right 1053633811 9:39974082-39974104 TCTTATGTAAGATTAACTTATGG No data
1053633808_1053633811 -8 Left 1053633808 9:39974067-39974089 CCATTGCCTTCTTCCTCTTATGT No data
Right 1053633811 9:39974082-39974104 TCTTATGTAAGATTAACTTATGG No data
1053633807_1053633811 10 Left 1053633807 9:39974049-39974071 CCATTTTTCTTTTGTTAGCCATT No data
Right 1053633811 9:39974082-39974104 TCTTATGTAAGATTAACTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053633811 Original CRISPR TCTTATGTAAGATTAACTTA TGG Intergenic
No off target data available for this crispr