ID: 1053637542

View in Genome Browser
Species Human (GRCh38)
Location 9:40027154-40027176
Sequence CTGTTGTTGTTAAGAAAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053637542_1053637545 26 Left 1053637542 9:40027154-40027176 CCTTATTTTCTTAACAACAACAG No data
Right 1053637545 9:40027203-40027225 TGCCGCATGCACCTAGAATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053637542 Original CRISPR CTGTTGTTGTTAAGAAAATA AGG (reversed) Intergenic
No off target data available for this crispr