ID: 1053641621

View in Genome Browser
Species Human (GRCh38)
Location 9:40088011-40088033
Sequence CAGGCACATGGTGTTGTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053641610_1053641621 28 Left 1053641610 9:40087960-40087982 CCTGCCTTCTGGCTGCTTTTGTG No data
Right 1053641621 9:40088011-40088033 CAGGCACATGGTGTTGTTGGTGG No data
1053641613_1053641621 24 Left 1053641613 9:40087964-40087986 CCTTCTGGCTGCTTTTGTGGGCT No data
Right 1053641621 9:40088011-40088033 CAGGCACATGGTGTTGTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053641621 Original CRISPR CAGGCACATGGTGTTGTTGG TGG Intergenic
No off target data available for this crispr