ID: 1053643335

View in Genome Browser
Species Human (GRCh38)
Location 9:40107704-40107726
Sequence GAGTTGAATTTGAAGTTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053643329_1053643335 1 Left 1053643329 9:40107680-40107702 CCCCAACTCGGACAGAAGGCCCA No data
Right 1053643335 9:40107704-40107726 GAGTTGAATTTGAAGTTTGTGGG No data
1053643326_1053643335 13 Left 1053643326 9:40107668-40107690 CCACTAGGGGTACCCCAACTCGG No data
Right 1053643335 9:40107704-40107726 GAGTTGAATTTGAAGTTTGTGGG No data
1053643331_1053643335 -1 Left 1053643331 9:40107682-40107704 CCAACTCGGACAGAAGGCCCATG No data
Right 1053643335 9:40107704-40107726 GAGTTGAATTTGAAGTTTGTGGG No data
1053643330_1053643335 0 Left 1053643330 9:40107681-40107703 CCCAACTCGGACAGAAGGCCCAT No data
Right 1053643335 9:40107704-40107726 GAGTTGAATTTGAAGTTTGTGGG No data
1053643322_1053643335 30 Left 1053643322 9:40107651-40107673 CCAGGGTGCGCGTCGGGCCACTA No data
Right 1053643335 9:40107704-40107726 GAGTTGAATTTGAAGTTTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053643335 Original CRISPR GAGTTGAATTTGAAGTTTGT GGG Intergenic
No off target data available for this crispr