ID: 1053643437

View in Genome Browser
Species Human (GRCh38)
Location 9:40108212-40108234
Sequence CAGTCCCTGCACTGGGACCC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053643431_1053643437 1 Left 1053643431 9:40108188-40108210 CCACGGACGAAAGTGTCTTCCCA No data
Right 1053643437 9:40108212-40108234 CAGTCCCTGCACTGGGACCCGGG No data
1053643428_1053643437 10 Left 1053643428 9:40108179-40108201 CCTGATTCCCCACGGACGAAAGT No data
Right 1053643437 9:40108212-40108234 CAGTCCCTGCACTGGGACCCGGG No data
1053643429_1053643437 3 Left 1053643429 9:40108186-40108208 CCCCACGGACGAAAGTGTCTTCC No data
Right 1053643437 9:40108212-40108234 CAGTCCCTGCACTGGGACCCGGG No data
1053643430_1053643437 2 Left 1053643430 9:40108187-40108209 CCCACGGACGAAAGTGTCTTCCC No data
Right 1053643437 9:40108212-40108234 CAGTCCCTGCACTGGGACCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053643437 Original CRISPR CAGTCCCTGCACTGGGACCC GGG Intergenic
No off target data available for this crispr