ID: 1053651091

View in Genome Browser
Species Human (GRCh38)
Location 9:40170583-40170605
Sequence GTGGCGGTTCAGCAATTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053651083_1053651091 10 Left 1053651083 9:40170550-40170572 CCCCAGGCCATGACGGAAACTTT No data
Right 1053651091 9:40170583-40170605 GTGGCGGTTCAGCAATTTGATGG No data
1053651078_1053651091 21 Left 1053651078 9:40170539-40170561 CCCTAAGATCCCCCCAGGCCATG No data
Right 1053651091 9:40170583-40170605 GTGGCGGTTCAGCAATTTGATGG No data
1053651081_1053651091 12 Left 1053651081 9:40170548-40170570 CCCCCCAGGCCATGACGGAAACT No data
Right 1053651091 9:40170583-40170605 GTGGCGGTTCAGCAATTTGATGG No data
1053651077_1053651091 22 Left 1053651077 9:40170538-40170560 CCCCTAAGATCCCCCCAGGCCAT No data
Right 1053651091 9:40170583-40170605 GTGGCGGTTCAGCAATTTGATGG No data
1053651079_1053651091 20 Left 1053651079 9:40170540-40170562 CCTAAGATCCCCCCAGGCCATGA No data
Right 1053651091 9:40170583-40170605 GTGGCGGTTCAGCAATTTGATGG No data
1053651084_1053651091 9 Left 1053651084 9:40170551-40170573 CCCAGGCCATGACGGAAACTTTG No data
Right 1053651091 9:40170583-40170605 GTGGCGGTTCAGCAATTTGATGG No data
1053651082_1053651091 11 Left 1053651082 9:40170549-40170571 CCCCCAGGCCATGACGGAAACTT No data
Right 1053651091 9:40170583-40170605 GTGGCGGTTCAGCAATTTGATGG No data
1053651086_1053651091 3 Left 1053651086 9:40170557-40170579 CCATGACGGAAACTTTGTTAGCG No data
Right 1053651091 9:40170583-40170605 GTGGCGGTTCAGCAATTTGATGG No data
1053651085_1053651091 8 Left 1053651085 9:40170552-40170574 CCAGGCCATGACGGAAACTTTGT No data
Right 1053651091 9:40170583-40170605 GTGGCGGTTCAGCAATTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053651091 Original CRISPR GTGGCGGTTCAGCAATTTGA TGG Intergenic
No off target data available for this crispr