ID: 1053656384

View in Genome Browser
Species Human (GRCh38)
Location 9:40221985-40222007
Sequence CAACCACTATGGCCCCTGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053656375_1053656384 27 Left 1053656375 9:40221935-40221957 CCAAAGGACGGGAACTGGCCGTT No data
Right 1053656384 9:40221985-40222007 CAACCACTATGGCCCCTGAGCGG No data
1053656380_1053656384 -4 Left 1053656380 9:40221966-40221988 CCCAGTTCCACAGAGAACTCAAC No data
Right 1053656384 9:40221985-40222007 CAACCACTATGGCCCCTGAGCGG No data
1053656381_1053656384 -5 Left 1053656381 9:40221967-40221989 CCAGTTCCACAGAGAACTCAACC No data
Right 1053656384 9:40221985-40222007 CAACCACTATGGCCCCTGAGCGG No data
1053656377_1053656384 2 Left 1053656377 9:40221960-40221982 CCCCATCCCAGTTCCACAGAGAA No data
Right 1053656384 9:40221985-40222007 CAACCACTATGGCCCCTGAGCGG No data
1053656378_1053656384 1 Left 1053656378 9:40221961-40221983 CCCATCCCAGTTCCACAGAGAAC No data
Right 1053656384 9:40221985-40222007 CAACCACTATGGCCCCTGAGCGG No data
1053656376_1053656384 9 Left 1053656376 9:40221953-40221975 CCGTTCACCCCATCCCAGTTCCA No data
Right 1053656384 9:40221985-40222007 CAACCACTATGGCCCCTGAGCGG No data
1053656379_1053656384 0 Left 1053656379 9:40221962-40221984 CCATCCCAGTTCCACAGAGAACT No data
Right 1053656384 9:40221985-40222007 CAACCACTATGGCCCCTGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053656384 Original CRISPR CAACCACTATGGCCCCTGAG CGG Intergenic
No off target data available for this crispr