ID: 1053659314

View in Genome Browser
Species Human (GRCh38)
Location 9:40255568-40255590
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 5, 1: 14, 2: 2, 3: 7, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053659314 Original CRISPR CAGTGTTGCAAAGATGATGC AGG (reversed) Intronic
902678564 1:18026984-18027006 CACTGTGGCAAAGAAGAAGCTGG + Intergenic
906205171 1:43982672-43982694 CTGGGTAGCAAAGATGAGGCTGG + Intronic
910597451 1:88994481-88994503 CAGCCTTGCAAAAATGATTCTGG + Intergenic
911269140 1:95779535-95779557 CAGTTTTGCAAAGAAGTTTCAGG + Intergenic
912715609 1:111981713-111981735 CACAGTGGCAAAGATGATGATGG + Exonic
913265516 1:117039315-117039337 CAGTGGTACAAAGGTGAGGCAGG + Intergenic
915792379 1:158687917-158687939 CATTCTTGCTAAGATGATTCTGG - Intergenic
916208184 1:162335597-162335619 GTGTGTTGCAGAGATGTTGCTGG + Intronic
916588980 1:166172019-166172041 GAGTGTAGCAAAGATGAAGAGGG - Intergenic
918313443 1:183303208-183303230 CAGTTTTGCAAAGTTGCTCCAGG - Intronic
918545174 1:185674105-185674127 CAGTGTTCCAAAGAAGCTGAAGG - Intergenic
920173890 1:204088277-204088299 CATTGGTGCAAAGGGGATGCTGG + Intronic
924441847 1:244092735-244092757 CAGTGGTGCATAGATGATAGAGG - Intergenic
1066668143 10:37807146-37807168 CAGTCTTAAAAAAATGATGCTGG - Intronic
1067040265 10:42948648-42948670 CAATGGAGCAAAGATGATGCTGG + Intergenic
1076284172 10:129277219-129277241 CAGTGCTGAGAAGAGGATGCAGG + Intergenic
1076313794 10:129526725-129526747 CAGAGCTGCAAAGATGGTCCTGG + Intronic
1080270498 11:30446350-30446372 CAGTGATGCCAAGATCAAGCCGG - Intronic
1081835312 11:46148943-46148965 CAGTGTTGCAGATCTAATGCAGG - Intergenic
1084186076 11:67472377-67472399 CAGCGTAGCAAGGCTGATGCAGG + Intergenic
1084371071 11:68743849-68743871 CAGTGTAACAAAGGAGATGCAGG + Intronic
1086572138 11:88297417-88297439 CAGTGTTGCACAGCTAATGAGGG - Intronic
1088972781 11:114788180-114788202 CCGTGTTGAAAGGCTGATGCTGG - Intergenic
1095270191 12:40209694-40209716 CAGTTGTGCAAACATGATTCCGG + Intronic
1096043503 12:48541635-48541657 CAGTCCTGCAAAGATAATGCAGG + Intergenic
1096562103 12:52443100-52443122 CAGAGTTCCTAAGATGAGGCAGG + Intergenic
1098592739 12:72232644-72232666 GAGTTTAGCAAAGAGGATGCTGG - Intronic
1099743554 12:86671873-86671895 CAGTATTGGACAGATGATGTAGG + Intronic
1099837840 12:87929937-87929959 CAGTTTAGTAAATATGATGCAGG - Intergenic
1100844479 12:98644851-98644873 CAGTGAAGCAACGAGGATGCCGG - Exonic
1102870461 12:116410133-116410155 AAGTGGTTCAAAGATGCTGCTGG - Intergenic
1105268609 13:18847622-18847644 CAATGTTGCAAAGATGATGCAGG + Intergenic
1106709821 13:32318183-32318205 CAACAGTGCAAAGATGATGCTGG - Intronic
1106846837 13:33745873-33745895 GAGTGTTTCAAAGATGCTGATGG + Intergenic
1107515512 13:41124998-41125020 CAGCACTGCAAAGATGATTCAGG - Intergenic
1110942935 13:81373707-81373729 CAATCTTCCAAATATGATGCCGG + Intergenic
1113874848 13:113587797-113587819 GAGTTTTGAAAAGATGATGTTGG + Intronic
1114523884 14:23356073-23356095 CTGTGGTGCAAAGCTGAGGCTGG + Intergenic
1116533676 14:46005169-46005191 CAGTAAAGCAAAGAAGATGCAGG - Intergenic
1116982975 14:51190688-51190710 CAGTGTTGGTAAGATGATAAAGG + Intergenic
1118181331 14:63496172-63496194 CAGTGTTGGAATAATGTTGCTGG - Intronic
1120704281 14:87731335-87731357 CACTGTTGCAAATCTGCTGCAGG - Intergenic
1121688861 14:95860186-95860208 CAGAGTTGAAAAAATAATGCAGG - Intergenic
1121925773 14:97926061-97926083 CAGGGTTGCAAGGATGAGTCAGG - Exonic
1122470542 14:101963211-101963233 CAGTTTTTCAAAGATGATTTGGG + Intergenic
1202830694 14_GL000009v2_random:26334-26356 CAATGTTGCAAAGGTGATGCAGG - Intergenic
1202888924 14_KI270722v1_random:136856-136878 CGGTGTTGGAAAAATGGTGCTGG + Intergenic
1124164891 15:27317539-27317561 CAGTTTTCCAAAGATGAGGATGG - Intronic
1126425655 15:48524568-48524590 CAGAGTTGCAAAGAAGAAACGGG + Intronic
1128661329 15:69503098-69503120 CTGTATTGCAAACATGATGAAGG + Intergenic
1128705717 15:69836345-69836367 GAGTGTTGGAAGGATGCTGCTGG - Intergenic
1129011751 15:72424851-72424873 AAGAGTGGCAAAGATGAGGCTGG + Intergenic
1130694795 15:86120283-86120305 GAGTGTTGCAAAGACAAGGCTGG - Intergenic
1130958555 15:88644599-88644621 CTGTCTGCCAAAGATGATGCAGG - Intronic
1133645034 16:7756064-7756086 CAGTGTTGCGATGCTGAGGCTGG + Intergenic
1140923117 16:79557630-79557652 GAGTGTTGCAAAGATTAAGTGGG + Intergenic
1146955876 17:36936166-36936188 CACTCTTGCAAAGTTGATTCGGG - Intergenic
1147649107 17:42051814-42051836 CAGTGCTGCATGGAGGATGCTGG - Intronic
1148766234 17:50039995-50040017 CTATGTTGCTAAGATGACGCTGG + Intergenic
1154419415 18:14212379-14212401 CAATGTTGCAAAGATGATGCAGG - Intergenic
1156711726 18:39955709-39955731 CGGTGTTGGAAAAATTATGCTGG + Intergenic
1156865339 18:41883033-41883055 CAGAGTTGAGAAGATGAAGCAGG + Intergenic
1158217170 18:55112334-55112356 TAGAGTTGCAAAGAGGATTCAGG - Intergenic
1159642110 18:70875874-70875896 CAGTGTAGAAAAGAGTATGCAGG + Intergenic
1159885142 18:73896614-73896636 CAGAGGTGCCAAGGTGATGCTGG - Intergenic
1166631150 19:44409182-44409204 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632027 19:44415309-44415331 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
1166632455 19:44418994-44419016 GAGGGTTGCAAGGATGCTGCTGG + Intronic
1166637024 19:44459399-44459421 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
1167686321 19:50958982-50959004 CAGTGATGCAAGGATGGAGCTGG + Exonic
1168471174 19:56642423-56642445 AAATGTAGCTAAGATGATGCAGG + Intergenic
1202642001 1_KI270706v1_random:101442-101464 CAATGTTGCAAAGATGATGCAGG + Intergenic
1202664320 1_KI270708v1_random:103650-103672 CGGTGTTGGAAAAATGGTGCTGG + Intergenic
925016594 2:531798-531820 CAGTGTTGCAAACAAGAGGATGG + Intergenic
925759347 2:7169342-7169364 CAGTGGTGGCGAGATGATGCTGG + Intergenic
926841858 2:17089745-17089767 CAGTGTGGCTAAGATAAAGCAGG - Intergenic
932205104 2:69873451-69873473 CAATTTTGCAAAAATGATACAGG - Intronic
933291259 2:80440950-80440972 CAGTCTTGCAGAGAGGATGGTGG - Intronic
934497837 2:94824922-94824944 CAGTGTTGCAAAGATGCTGCAGG + Intergenic
938540996 2:132283388-132283410 GAGGGTTGCAAGGATGCTGCTGG - Intergenic
938541821 2:132289293-132289315 GTGTGTTGCAAGGATGCTGCTGG - Intergenic
938981436 2:136530890-136530912 CAGAGTTCCAAGGATGGTGCAGG + Intergenic
941099481 2:161280937-161280959 GAGGGTTGCAAGGATGCTGCTGG + Intergenic
942190141 2:173461655-173461677 CTGTGTGGCAAAGGTGATTCAGG + Intergenic
944904754 2:204251576-204251598 CTGTGCTGCCCAGATGATGCTGG - Intergenic
945749747 2:213766853-213766875 CAGTGTTGAAAGGAAGCTGCAGG - Intronic
947120480 2:226809042-226809064 CAGAGTTGAAAAGATGAGTCTGG + Intergenic
947391919 2:229648240-229648262 CTGGGTTGCAAACATGATCCTGG - Intronic
948666499 2:239537998-239538020 CAGGATTGCACAGATGATGAGGG + Intergenic
1169967753 20:11236483-11236505 CAGTGTGGTAAACATGATGCAGG - Intergenic
1170272554 20:14544556-14544578 TATTGTTGCAATGATGATGATGG + Intronic
1170309532 20:14976855-14976877 CAGTGTGGCAAATACAATGCGGG + Intronic
1171889109 20:30691632-30691654 CAATGTTGCAAAGATGATGCAGG + Intergenic
1174434343 20:50495055-50495077 CAGTGGTGAAAAGTTGATGCAGG + Intergenic
1175888429 20:62305139-62305161 CAGTGTTGCAAAGAATTTCCCGG + Intronic
1176609882 21:8871172-8871194 CAATGTTGCAAAGGTGATGCAGG - Intergenic
1176853890 21:13946919-13946941 CAATGTTGCAAAGATGATGCAGG + Intergenic
1178246647 21:30959381-30959403 CAGTGTAGCCAAGAAAATGCTGG + Intergenic
1178728670 21:35078905-35078927 CTGTGTGGCAAAGAAGATGTAGG + Intronic
1179022081 21:37649588-37649610 CAGCCTAGCAAAGGTGATGCGGG - Intronic
1180331049 22:11480534-11480556 CGGTGTTGGAAAAATGGTGCTGG + Intergenic
1180359943 22:11880422-11880444 CAATGTTGCAAAGATGATGCAGG - Intergenic
1182759652 22:32711958-32711980 CAGTGCTGGAAAGCTGAGGCAGG - Intronic
1183176433 22:36227829-36227851 CAATGTAGCAAAGGTGATGAAGG - Exonic
1184637210 22:45842428-45842450 CAGTATTCTAAAGATGAAGCTGG - Intronic
949777570 3:7649640-7649662 CTGTGTTACAAAGGTGATGATGG - Intronic
950508535 3:13411565-13411587 CAGTGTTGCAGAGGAGATGTGGG - Intronic
954688124 3:52381627-52381649 CCTTGGTGCACAGATGATGCAGG + Exonic
955650985 3:61193526-61193548 CATTGATGCAAAAATGCTGCAGG - Intronic
955761438 3:62288322-62288344 CAGTTTTGGAAATATGATGAAGG + Intronic
955811753 3:62798279-62798301 CAGTGTGGCTAAGATAAAGCAGG + Intronic
959151158 3:102609832-102609854 CAGTGTGGCCATGATGATGGAGG + Intergenic
966694771 3:182778456-182778478 AAGTTGTGCAAAGATGATGTTGG + Intergenic
967019638 3:185511472-185511494 CTGTTTTCCAAAGATGTTGCTGG - Intronic
967442475 3:189525217-189525239 TAGTGATGCAAAGAACATGCAGG - Intergenic
1202736564 3_GL000221v1_random:5961-5983 CAATGTTGCAAAGATGATGCAGG - Intergenic
969855965 4:9999842-9999864 CAGTGGTCCAAAGATCATGGTGG + Intronic
975447226 4:74480098-74480120 CAGAGTTTGAAAGATGATGAAGG + Intergenic
977101831 4:92825824-92825846 CAGTGTTGCTAAGAACATGAAGG - Intronic
981533007 4:145770931-145770953 CACTGTTGCTGGGATGATGCTGG - Intronic
982485756 4:155964066-155964088 CAGTGCTGCACAGATTATGTTGG - Intergenic
1202769370 4_GL000008v2_random:187308-187330 CAATGTTGCAAAGATGATGCAGG + Intergenic
988248842 5:28727141-28727163 CAGTGTGGCTAAGATAAAGCAGG + Intergenic
989454750 5:41630300-41630322 CAGTTTTGCCAAGGTGAGGCAGG + Intergenic
989969669 5:50507770-50507792 TAGTGCTGCAAAGAACATGCAGG - Intergenic
994714130 5:103301515-103301537 CAGAGTGGCGAAGATGAAGCCGG + Intergenic
995615394 5:113957253-113957275 CAGTCTTCAAAAAATGATGCTGG - Intergenic
999493411 5:152073610-152073632 CAGTTTTGCAAGGCTGTTGCGGG + Intergenic
1001947162 5:175789027-175789049 CAGTGTCACAAAGTTGATGAGGG + Intergenic
1005083670 6:21981772-21981794 CAGAGTAGCAAAGAGGAGGCAGG - Intergenic
1007176785 6:39902605-39902627 CAATGTTGGAAGGATGATGCAGG + Exonic
1008635060 6:53402555-53402577 CTTTGGTGTAAAGATGATGCTGG + Intergenic
1010728741 6:79365382-79365404 CTTTGGTGTAAAGATGATGCTGG + Intergenic
1010972029 6:82273280-82273302 CAGTGAGGCCAAGATGAAGCTGG - Intergenic
1011611935 6:89160847-89160869 AAGAGTTACAGAGATGATGCAGG + Intronic
1017592076 6:155988958-155988980 CAGTATTTCAAATATGATGATGG + Intergenic
1020867143 7:13580075-13580097 CAGTATTGCAAATATGACTCTGG - Intergenic
1021012986 7:15494557-15494579 CTGTGTAGCAAAGATGCTCCTGG + Intronic
1022526213 7:31039074-31039096 CAGTGTTGCAAAGACCGAGCTGG + Intergenic
1022947174 7:35298531-35298553 CTGTGTTGCAAAAATGAAGTTGG + Intergenic
1028526587 7:91793224-91793246 CATTGTTACCAGGATGATGCTGG - Intronic
1031100679 7:117476394-117476416 CAGTCTTACAAAGATGTTTCAGG - Intronic
1031439796 7:121779716-121779738 CAGTGTTTAAAAGATAATCCTGG - Intergenic
1031896243 7:127351496-127351518 AAGAGTTGCAAAGAAGATTCAGG - Intronic
1032597334 7:133254657-133254679 GAGTTTTGCAAAGATGAAGCAGG + Intronic
1032938539 7:136762305-136762327 TGATTTTGCAAAGATGATGCAGG + Intergenic
1033604071 7:142912566-142912588 CAGTGTGGCAATGATGGTGAAGG + Exonic
1035728144 8:1837297-1837319 CAGACTTGCAGAGCTGATGCAGG + Intronic
1037486274 8:19350280-19350302 CAGTGATGCAGAGCTGGTGCAGG - Intronic
1037825777 8:22159876-22159898 CAATGTTGCCAGGATGATGGGGG + Intronic
1038817346 8:30918364-30918386 CAGGGGTGCAGAGATAATGCAGG + Intergenic
1039397550 8:37240133-37240155 CAGTGCTGGAAAAATGATGGTGG - Intergenic
1041737206 8:61123832-61123854 GACTGTTGCAAAGAAAATGCTGG - Intronic
1041784840 8:61620459-61620481 CAGTGCTGCAAGAATAATGCAGG + Intronic
1043462830 8:80478084-80478106 GAGTGTTGGAGAGATGAGGCTGG + Intergenic
1043783384 8:84365403-84365425 CAGTGTTGCAAAACTAATGTTGG + Intronic
1045290395 8:100827841-100827863 CAGTGTCCCAAAGAGGAAGCTGG + Intergenic
1046568823 8:115936434-115936456 CACTGTTGCAAAGATTCTGGTGG + Intergenic
1047183402 8:122610723-122610745 CAGTGTGGCAAAGGTGGGGCAGG + Intergenic
1048641988 8:136373756-136373778 AAATGTTGCAAAGATGATCTAGG + Intergenic
1048798727 8:138176169-138176191 CAGTGTTGCAAAGCTCTTCCAGG + Intronic
1049429357 8:142552036-142552058 CAGGCTTGCAGAGATGATGCTGG + Intergenic
1052816102 9:33103544-33103566 CAGTCTTGGAAGGGTGATGCAGG - Intergenic
1053020094 9:34688660-34688682 CAGGATTGCAAAGATGGGGCTGG + Intergenic
1053124566 9:35569585-35569607 CACTGTTGTAGAGATGATGGGGG - Intergenic
1053659314 9:40255568-40255590 CAGTGTTGCAAAGATGATGCAGG - Intronic
1053909685 9:42884932-42884954 CAGTGTTGCAAAGATGATGCAGG - Intergenic
1054360350 9:64108331-64108353 CAATGTTGCAAAGATGATGCAGG - Intergenic
1054371441 9:64401870-64401892 CAGTGTTGCAAAGATGATGCAGG - Intronic
1054525284 9:66120648-66120670 CAGTGTTGCAAAGATGATGCAGG + Intronic
1054679062 9:67891585-67891607 CAGTGTTGCAAAGATGATGCAGG - Intronic
1057716041 9:97497069-97497091 CAGTGGTCCAAAGATGAGGTGGG + Intergenic
1057903333 9:98966016-98966038 CAGGGTTGGAAAGTGGATGCTGG + Intronic
1058894899 9:109391075-109391097 CACTGTCGCAACGATGATGAGGG - Intronic
1062207335 9:135344432-135344454 CAGTGCTGGACGGATGATGCAGG + Exonic
1062313969 9:135956324-135956346 CTGTTTTGCAGAGAGGATGCTGG - Intronic
1203694254 Un_GL000214v1:81024-81046 CAATGTTGCAAAGATGATGCAGG + Intergenic
1203705296 Un_KI270742v1:36401-36423 CAATGTTGCAAAGATGATGCAGG - Intergenic
1203558709 Un_KI270744v1:29404-29426 CAATGTTGCAAAGATGATGCAGG + Intergenic
1203642019 Un_KI270751v1:23039-23061 CAATGTTGCAAAGATGATGCAGG - Intergenic
1193010943 X:76674531-76674553 CAGTGTTGGAAAGTGGGTGCAGG + Intergenic
1196020814 X:110989049-110989071 CAGGACTGAAAAGATGATGCTGG - Intronic
1196068701 X:111495273-111495295 CAGTTTGGTAAAGAAGATGCAGG - Intergenic
1197856778 X:130921477-130921499 CAGTGGTGAAAAGATAATTCTGG - Intergenic
1198028802 X:132735270-132735292 CAGTGTGACAATGATGATTCTGG - Intronic
1199685131 X:150258767-150258789 CAGAAATGCAAAGATGAGGCTGG - Intergenic
1201417573 Y:13762606-13762628 CAATGTTGAAAAAATGATGGAGG + Intergenic
1201538100 Y:15073710-15073732 CAGTTTTGCAATGCTGATGTTGG + Intergenic