ID: 1053664346

View in Genome Browser
Species Human (GRCh38)
Location 9:40307136-40307158
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 768
Summary {0: 35, 1: 30, 2: 4, 3: 96, 4: 603}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053664343_1053664346 -10 Left 1053664343 9:40307123-40307145 CCAGCCATGGCTCAAAGATGCAC 0: 5
1: 42
2: 55
3: 77
4: 410
Right 1053664346 9:40307136-40307158 AAAGATGCACAGGTACAGCTTGG 0: 35
1: 30
2: 4
3: 96
4: 603
1053664342_1053664346 -4 Left 1053664342 9:40307117-40307139 CCAGCTCCAGCCATGGCTCAAAG 0: 24
1: 216
2: 410
3: 468
4: 658
Right 1053664346 9:40307136-40307158 AAAGATGCACAGGTACAGCTTGG 0: 35
1: 30
2: 4
3: 96
4: 603
1053664338_1053664346 29 Left 1053664338 9:40307084-40307106 CCTCAGGACACTGCTGGCTGCAT 0: 16
1: 84
2: 83
3: 153
4: 436
Right 1053664346 9:40307136-40307158 AAAGATGCACAGGTACAGCTTGG 0: 35
1: 30
2: 4
3: 96
4: 603
1053664340_1053664346 5 Left 1053664340 9:40307108-40307130 CCTGTAGTTCCAGCTCCAGCCAT 0: 2
1: 0
2: 46
3: 174
4: 685
Right 1053664346 9:40307136-40307158 AAAGATGCACAGGTACAGCTTGG 0: 35
1: 30
2: 4
3: 96
4: 603
1053664339_1053664346 6 Left 1053664339 9:40307107-40307129 CCCTGTAGTTCCAGCTCCAGCCA 0: 2
1: 0
2: 16
3: 85
4: 448
Right 1053664346 9:40307136-40307158 AAAGATGCACAGGTACAGCTTGG 0: 35
1: 30
2: 4
3: 96
4: 603

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
900695634 1:4008118-4008140 AAACAGGGACAGGTCCAGCTTGG - Intergenic
900906438 1:5562898-5562920 TCAGAGGCCCAGGTACAGCTTGG - Intergenic
901819092 1:11814709-11814731 GAAGAGGCACAGATTCAGCTTGG - Intronic
902540688 1:17152404-17152426 AAAGGGGCCCAGGTACAGCTTGG + Intergenic
904387320 1:30152101-30152123 GGAGGTGCCCAGGTACAGCTTGG + Intergenic
904745153 1:32706127-32706149 AAAGATGCAGAATCACAGCTTGG + Intergenic
905002020 1:34680048-34680070 AAAGGGGCCCAGGTACAGCTCGG - Intergenic
905225895 1:36479049-36479071 AAAGAAGCCCAGGCAGAGCTTGG - Intronic
906153382 1:43600540-43600562 ACAGAAGCACAGGGACAGCTGGG - Intronic
906310879 1:44753459-44753481 CAAGATGCATAGGAAGAGCTTGG + Intronic
906451911 1:45957492-45957514 AAAGAAGAACACGTACAGTTGGG - Intronic
906655115 1:47542609-47542631 AAAGATGCCAAGGTGTAGCTCGG + Intergenic
906745590 1:48220133-48220155 AAAGCTACACAGGGACAGCAAGG - Intergenic
908539815 1:65111740-65111762 AAAGGGCCCCAGGTACAGCTTGG - Intergenic
908988223 1:70052128-70052150 TAAGATACACAAGTACTGCTTGG - Intronic
909105181 1:71397952-71397974 AATGAAGCCAAGGTACAGCTTGG + Exonic
909167425 1:72246984-72247006 ACAGAAGCCCAGGTACAGCTCGG - Intronic
909373488 1:74914095-74914117 AAAAAGGCCAAGGTACAGCTTGG - Intergenic
911790912 1:102014402-102014424 AAAGAGGCCAAGGTACAGCTTGG + Intergenic
912073144 1:105839338-105839360 AAAAAGGCCAAGGTACAGCTTGG + Intergenic
912084010 1:105976819-105976841 AAAGGTGCCAAGATACAGCTTGG + Intergenic
912086625 1:106014174-106014196 AAAGGAGCACAGGTATAACTAGG - Intergenic
912113497 1:106372949-106372971 AAAGAGGCCAAGGTACAACTTGG - Intergenic
912147337 1:106809664-106809686 AAAGGGGCCAAGGTACAGCTGGG - Intergenic
912148256 1:106821539-106821561 AAAGATACAAAATTACAGCTAGG - Intergenic
912735914 1:112149467-112149489 AAAGAGGCCAAGGTACAGCTTGG + Intergenic
912890417 1:113524013-113524035 AAAGGGGCCAAGGTACAGCTCGG + Intronic
913396373 1:118376619-118376641 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
913710011 1:121473320-121473342 AAACAGGCCAAGGTACAGCTTGG - Intergenic
914857380 1:151362619-151362641 AAAGGGGCCCAGGTATAGCTTGG + Intergenic
915500822 1:156315992-156316014 AAAGATGCAAAGGTCAAGCAAGG + Intronic
916477375 1:165183232-165183254 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
917002503 1:170375161-170375183 AAAGGGGCCCAGGTACAGCTTGG - Intergenic
918207260 1:182320512-182320534 AAAAATTCACTGGTACATCTTGG + Intergenic
918757699 1:188358115-188358137 AAAGGAGCCCAGGTACAGCTTGG - Intergenic
918766942 1:188499075-188499097 AAAGAGGTCCAGGCACAGCTTGG + Intergenic
919156814 1:193776126-193776148 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
919291946 1:195643794-195643816 AAAGGAGCCAAGGTACAGCTTGG - Intergenic
919582927 1:199399918-199399940 GAAGGTGGTCAGGTACAGCTTGG - Intergenic
920683311 1:208089917-208089939 AAAGATGCACATGCCCAACTTGG - Intronic
921128021 1:212195411-212195433 AAAGGAGCCCAGGTATAGCTTGG + Intergenic
921641026 1:217554383-217554405 AGAGATGCTCAAGTACAGATAGG - Intronic
921816027 1:219564363-219564385 AACCATGCACAATTACAGCTGGG + Intergenic
921925325 1:220706217-220706239 GAAGATGCCCAGATTCAGCTAGG - Intergenic
922530448 1:226341230-226341252 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
923178640 1:231494612-231494634 GAAGATGCACAGGAACTGATAGG - Intergenic
1064563257 10:16613483-16613505 AAAGATGCCCAGGCTCAGATGGG - Intronic
1064584178 10:16823016-16823038 AAAGGGGCCCAGGTACAGCTTGG + Intergenic
1065534207 10:26701496-26701518 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1065857055 10:29839206-29839228 AAAGCTGGCCAGATACAGCTGGG - Intergenic
1066612863 10:37267748-37267770 AAAGATGCACTGTTTCTGCTGGG + Intronic
1066695878 10:38077119-38077141 AAAGGGGCCCAGGTGCAGCTTGG - Intergenic
1067206086 10:44215224-44215246 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1067666639 10:48284944-48284966 AGACATGCAGAGGGACAGCTAGG - Intergenic
1068011303 10:51455165-51455187 AAAGAGGCCAAGGTAGAGCTTGG - Intronic
1068350208 10:55833597-55833619 AAACATGCACATGTACCCCTTGG + Intergenic
1069562512 10:69440822-69440844 AAAGATGCGCAGTTGCACCTGGG + Intergenic
1069933420 10:71899196-71899218 TAAGAAGGACGGGTACAGCTGGG - Intergenic
1070948132 10:80409419-80409441 AAAGAGGCGCAGGAGCAGCTGGG - Intronic
1071307989 10:84315992-84316014 AAAGATGCATAGGCAGAGGTAGG - Intergenic
1071327773 10:84534090-84534112 AAAGGTGCCAAGGTACAGCTCGG + Intergenic
1071981041 10:91004505-91004527 AAAGAGGCCAAGGTACAGCTCGG - Intergenic
1072368952 10:94744580-94744602 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1073676894 10:105658185-105658207 GAAGATGCCCAGGTACAGAGAGG + Intergenic
1073922940 10:108480486-108480508 AAAGGAGCCAAGGTACAGCTCGG + Intergenic
1074640230 10:115370998-115371020 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1075281674 10:121144080-121144102 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1076447160 10:130524567-130524589 CAAGGTGCACAGGGAAAGCTAGG - Intergenic
1076662686 10:132065803-132065825 TAAGGTGCACAGGGAGAGCTTGG + Intergenic
1077010164 11:376069-376091 AACGAAGGACAGGTACACCTGGG - Exonic
1077426231 11:2479508-2479530 AAAGGTGTCAAGGTACAGCTTGG - Intronic
1077740849 11:4843493-4843515 AAAGGAGCCAAGGTACAGCTCGG - Intronic
1077827448 11:5826445-5826467 AAAGAGGCCAAGGTACGGCTTGG + Intronic
1078053944 11:7991864-7991886 AAAACTGCAGAGGGACAGCTTGG - Intronic
1078698601 11:13659727-13659749 AAAGGAGCCCAGGTGCAGCTTGG + Intergenic
1079335688 11:19568490-19568512 AAAGATCCATCTGTACAGCTTGG - Intronic
1079554324 11:21740405-21740427 AAAAGTTCCCAGGTACAGCTTGG - Intergenic
1079737327 11:24013146-24013168 AAAGGAGCCCAGTTACAGCTTGG + Intergenic
1079744397 11:24106826-24106848 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1080982400 11:37424092-37424114 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1081051791 11:38350374-38350396 GAAGGGGCCCAGGTACAGCTTGG - Intergenic
1081238893 11:40679594-40679616 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1081354395 11:42095167-42095189 AAAGAGGCCAAGGTACTGCTTGG + Intergenic
1081376770 11:42368359-42368381 AAAGAGACCAAGGTACAGCTTGG + Intergenic
1082711737 11:56561095-56561117 AAAAGTGCCAAGGTACAGCTTGG + Intergenic
1082733149 11:56824778-56824800 AAAGGGACCCAGGTACAGCTTGG - Intergenic
1082759320 11:57111624-57111646 CAAGAGGCACAGGTTGAGCTTGG - Intergenic
1083136121 11:60678305-60678327 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1084507302 11:69576240-69576262 AAAGGTTCACAGGTAGGGCTGGG - Intergenic
1084951235 11:72666808-72666830 AAAGATGGACAGTCACAGCCGGG + Intronic
1085651262 11:78270819-78270841 GAGGTTGCACAGGTAAAGCTTGG - Intronic
1085651517 11:78272911-78272933 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1085941844 11:81214218-81214240 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
1087668950 11:101083133-101083155 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1089746164 11:120618692-120618714 AAAGGGGCCCAGGTACAGCGTGG + Intronic
1090319651 11:125831231-125831253 AAAGGGGCTCTGGTACAGCTTGG - Intergenic
1091786973 12:3248975-3248997 AAAAATGCACAGGAACGGGTGGG - Intronic
1093192593 12:16092088-16092110 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
1093371889 12:18375847-18375869 AAAGGGGCGCAGGTACCGCTTGG + Intronic
1093570508 12:20661610-20661632 AAAGAGGCCAAGGTACAGCTTGG + Intronic
1093585818 12:20835111-20835133 AAAGGGGCCAAGGTACAGCTTGG - Intronic
1093967284 12:25340829-25340851 AAAGAGGACAAGGTACAGCTTGG - Intergenic
1094379880 12:29831259-29831281 AAAGAGGCCCAGGTACAGCTTGG - Intergenic
1094397626 12:30025076-30025098 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1095731569 12:45511667-45511689 AAAGGGGCCAAGGTACAGCTGGG - Intergenic
1095782719 12:46078127-46078149 CAAGGGGTACAGGTACAGCTAGG - Intergenic
1096886903 12:54727181-54727203 AAACAGGCCAAGGTACAGCTTGG - Intergenic
1096904909 12:54926560-54926582 AAAGAGGCCAAGGTACAGGTTGG + Intergenic
1097411000 12:59253021-59253043 AAAGAGGCCAAAGTACAGCTTGG + Intergenic
1097467211 12:59941904-59941926 AAAGATTCCCTGGTACTGCTTGG + Intergenic
1098630904 12:72720638-72720660 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1098774877 12:74600218-74600240 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1098830936 12:75361538-75361560 AAACAGGCTGAGGTACAGCTTGG - Intronic
1098837702 12:75441894-75441916 AAAGGGGCCAAGGTACAGCTGGG + Intergenic
1098939559 12:76518755-76518777 AAAGGGGCCCAGGTACAGCTTGG - Intronic
1099384427 12:81997556-81997578 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
1099386431 12:82018768-82018790 AAAGGGGCCCAAGTACAGCTTGG + Intergenic
1099627184 12:85090071-85090093 AAAGGAGCCCAGGCACAGCTTGG + Intronic
1099746236 12:86708218-86708240 AAAGAGGCAAAAGTACAGCTTGG + Intronic
1099860716 12:88222440-88222462 AAAGGTGCCCAGGTATAGCTTGG + Intergenic
1099984652 12:89648889-89648911 AAAGGGGCCCAGGAACAGCTTGG + Intronic
1100060278 12:90566529-90566551 AAAGGTGCTGAGATACAGCTTGG - Intergenic
1100123404 12:91395118-91395140 AAAGAGGTCAAGGTACAGCTTGG + Intergenic
1100129051 12:91467677-91467699 AAGGATACACATGTACAGTTAGG + Intergenic
1100454737 12:94741331-94741353 AAAGATGAGCAGGGACAGCCAGG + Intergenic
1100787656 12:98095919-98095941 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1100933638 12:99638880-99638902 AAAGGTGCCAAGGTACAGCTCGG + Intronic
1100937924 12:99691095-99691117 AAAGGGGCAAAGGTACAGCTTGG - Intronic
1101526410 12:105535159-105535181 AAAGTGGCCAAGGTACAGCTCGG - Intergenic
1103264569 12:119618096-119618118 AAAGGAGCCAAGGTACAGCTTGG + Intronic
1103358167 12:120337096-120337118 AAAGGAGCCAAGGTACAGCTCGG - Intergenic
1105257200 13:18751650-18751672 AAAGATGCGCAGGTACAGCTTGG - Intergenic
1105259864 13:18771012-18771034 AAAGATGCACAGGTACAGCTTGG - Intergenic
1105262544 13:18790335-18790357 AAAGATGCACAGGTACAGCTTGG - Intergenic
1105264465 13:18803791-18803813 AAAGATGCACAGGTACAGCTTGG - Intergenic
1105321222 13:19324041-19324063 AATGGGGCTCAGGTACAGCTTGG - Intergenic
1105650549 13:22372364-22372386 AAAGAGGCCAAGGTACAGCTTGG - Intergenic
1105657511 13:22456858-22456880 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1106614437 13:31313956-31313978 AAAGAGGCCAAAGTACAGCTTGG + Intronic
1106614709 13:31315895-31315917 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1106678293 13:31984632-31984654 AAAGGTGCCAAGGTACAGCTCGG + Intergenic
1107140451 13:36993012-36993034 GAAGATGCACAGCCTCAGCTGGG + Intronic
1108105787 13:47007387-47007409 AAAGATGGGCAGGTGCAGGTAGG + Intergenic
1108423894 13:50278438-50278460 AAAAATGAACAAGGACAGCTTGG + Intronic
1108591600 13:51917431-51917453 AAAGATGGACAGGCACCCCTAGG + Intergenic
1108936806 13:55891580-55891602 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
1108944399 13:56003049-56003071 AAAGAGGGTAAGGTACAGCTTGG - Intergenic
1109091505 13:58052148-58052170 AAAACGGCCCAGGTACAGCTTGG + Intergenic
1109252186 13:60032541-60032563 AAAGTGGCCCTGGTACAGCTTGG - Intronic
1109334875 13:60981313-60981335 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1109503619 13:63270242-63270264 AAAGAGGCCCAGGTACAGCTTGG - Intergenic
1110038397 13:70718096-70718118 AAAGGGGCCAAGGTACAGCTCGG + Intergenic
1110189479 13:72714684-72714706 AAAGTGGCCCAGGTATAGCTTGG + Intronic
1110670007 13:78166817-78166839 AAAGATGCAAAGTTTCAGTTAGG - Intergenic
1110892946 13:80713017-80713039 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1111051204 13:82884655-82884677 AAAGGGGCCCAAGTACAGCTTGG - Intergenic
1111154909 13:84309679-84309701 AAAGGGGCCAAGGTACAGCTCGG + Intergenic
1111189540 13:84790144-84790166 AAAGAGGCCACGGTACAGCTAGG + Intergenic
1111479927 13:88811072-88811094 ATAGGGGCCCAGGTACAGCTTGG + Intergenic
1111527630 13:89492580-89492602 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
1112451006 13:99509565-99509587 AAAGAGGCTGAGGTACAGCTTGG - Intronic
1112512229 13:100020142-100020164 AAAGAGGCCAAGGTACAGCTCGG + Intergenic
1112744191 13:102508697-102508719 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1113087756 13:106585717-106585739 AAAGAGGCCAAGGTACAGCTTGG + Intergenic
1113341792 13:109432894-109432916 AAAAGGGCAAAGGTACAGCTCGG - Intergenic
1113384664 13:109837501-109837523 AAAGATACACAGGAAGTGCTTGG - Intergenic
1114140216 14:19901258-19901280 AAAGGGTCCCAGGTACAGCTTGG + Intergenic
1114918546 14:27296951-27296973 AAAGGGACCCAGGTACAGCTTGG - Intergenic
1114986726 14:28238851-28238873 AAAGGGGCTAAGGTACAGCTTGG + Intergenic
1115051873 14:29072716-29072738 AAAGAGGCCAAGGTATAGCTTGG - Intergenic
1115121377 14:29941728-29941750 AAAGGGGGCCAGGTACAGCTTGG + Intronic
1115134780 14:30095572-30095594 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1115473991 14:33796942-33796964 ACAGATGCACAGGTGCACCTTGG - Intronic
1115878764 14:37891791-37891813 AAAGAGGCCAAGGTACAGCTTGG + Intronic
1116369334 14:44109758-44109780 AAACACGCCCAGGTACAGTTTGG + Intergenic
1116811129 14:49541072-49541094 AAAGGGGCTCAGGTACAACTTGG + Intergenic
1116847115 14:49875178-49875200 AAAGAAATACAGGTCCAGCTGGG + Intergenic
1117084124 14:52181431-52181453 AAAGGGGCCAAGGTACAGCTGGG - Intergenic
1117241344 14:53837095-53837117 AAAGTGGCCTAGGTACAGCTTGG - Intergenic
1118488198 14:66233893-66233915 AAAGAGCCAAAGGTACAGATGGG - Intergenic
1118755258 14:68838487-68838509 ACAGGAGCCCAGGTACAGCTTGG + Intergenic
1119450159 14:74702426-74702448 AAAGGAGCCAAGGTACAGCTTGG - Intronic
1120342931 14:83245067-83245089 AAAGAGGCTGAGGTACAGCTTGG + Intergenic
1120407050 14:84103275-84103297 GAAGAGGCCAAGGTACAGCTTGG + Intergenic
1120457763 14:84754427-84754449 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1120636963 14:86965007-86965029 AAAGAGACCAAGGTACAGCTTGG + Intergenic
1120659046 14:87230825-87230847 AAAGGGGCAAAGGTACAGTTTGG - Intergenic
1121166499 14:91807001-91807023 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1121672554 14:95723992-95724014 AAACAGCCCCAGGTACAGCTTGG + Intergenic
1122379961 14:101295784-101295806 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1202833982 14_GL000009v2_random:64277-64299 AAAGATGCACAGGTACAGCTTGG + Intergenic
1125230771 15:37452787-37452809 AAAGAGACCAAGGTACAGCTTGG + Intergenic
1125407823 15:39371388-39371410 AAAGAGGCCCAGATACAGTTTGG - Intergenic
1126989840 15:54361984-54362006 AAAGATTCACATGAACATCTGGG + Intronic
1127151977 15:56085164-56085186 AAATATGCTCAGATATAGCTTGG + Intergenic
1127325681 15:57892888-57892910 AAGGATGCAGAGATACAGCAAGG - Intergenic
1127639057 15:60898159-60898181 AAAGAAGCAGAGGCTCAGCTTGG + Intronic
1127693570 15:61421656-61421678 AAGCATGAACAGATACAGCTTGG + Intergenic
1128119792 15:65137180-65137202 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1129433277 15:75517036-75517058 AAAAATGCACAGGAACGGCCAGG - Intronic
1129901065 15:79149820-79149842 AAAGGAGCCAAGGTACAGCTTGG - Intergenic
1131198871 15:90379613-90379635 AAAGGGGCCCAAGTACAGCTTGG - Intergenic
1131659502 15:94498821-94498843 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1132121964 15:99183977-99183999 GAAGGGGCAAAGGTACAGCTTGG + Intronic
1133019696 16:2961905-2961927 GCAGATGCACAGGTGCAGATTGG - Intergenic
1133356865 16:5143164-5143186 AACCATGCACAGGTCCAGTTAGG - Intergenic
1133512782 16:6476346-6476368 ATAGATGTACAGGCACACCTTGG + Intronic
1134896288 16:17889780-17889802 CAAGATGCACAGACAGAGCTTGG - Intergenic
1135222545 16:20625333-20625355 AAGGCTGCACAGGTAAAGCCTGG + Intronic
1137818591 16:51422396-51422418 AAAGGAGCCAAGGTACAGCTCGG - Intergenic
1139970115 16:70769109-70769131 AAAAATGCACATCCACAGCTGGG - Intronic
1141935735 16:87236727-87236749 AAAGAAGCAAAGGTACAGAGGGG + Intronic
1142585279 17:968410-968432 AAAGATACACAGATGCAGCCCGG + Intronic
1142681902 17:1554937-1554959 GGAGAGGCACAGGGACAGCTTGG - Intronic
1143455990 17:7068130-7068152 AAAGGGGCCCAGGTACAGCTTGG - Intergenic
1144538538 17:16115153-16115175 AAAGGGGCCAAGGTACAGCTTGG - Intronic
1144950632 17:18991793-18991815 TAAGATGCACAGGGACCACTGGG - Intronic
1146097852 17:29949719-29949741 AAAGAAGCACAGCAACAGCAGGG - Intronic
1146132451 17:30291169-30291191 AATGAGGCACAGGTACAGGCAGG - Intronic
1146149378 17:30453896-30453918 AAAGGGGCCAAGGTACAGCTCGG - Intronic
1147040767 17:37717010-37717032 AGAGATGCACTGGTTCTGCTGGG + Intronic
1149116039 17:53097623-53097645 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1149260693 17:54877002-54877024 AAAGGGGCCAAGGTACAGCTCGG + Intergenic
1149370987 17:55993196-55993218 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
1150687367 17:67331569-67331591 AAAGGGGCCAAGGTACAGCTAGG + Intergenic
1150743636 17:67799213-67799235 AAAAATGCACAGGATCGGCTGGG - Intergenic
1151177627 17:72301789-72301811 AAAGGTTGAGAGGTACAGCTGGG + Intergenic
1151898842 17:76998328-76998350 AATGAAGCAAAGGTACAGTTAGG - Intergenic
1151902019 17:77022578-77022600 AAAGGGGCCCAGGTACAGCTGGG + Intergenic
1153136894 18:1927447-1927469 AAAGGGGCCAAGGTACAGCTCGG + Intergenic
1153262873 18:3241378-3241400 AAAGGGGCCAAGGTACAGCTCGG + Intergenic
1153455040 18:5271433-5271455 AAAGAGGCCAAGATACAGCTTGG - Intergenic
1153846056 18:9050913-9050935 AAAGAGGCCAATGTACAGCTTGG + Intergenic
1154423924 18:14257770-14257792 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154425258 18:14267223-14267245 AAAGATGCACAGGAACAGCTTGG + Intergenic
1154426158 18:14273789-14273811 AAAGATGCACAGGTACAACTTGG + Intergenic
1154427992 18:14286811-14286833 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154428893 18:14293379-14293401 AAAGATGCACAGGTACAGCTTGG + Intergenic
1154430705 18:14306321-14306343 AAAGATGGACAGGTACAGCTTGG + Intergenic
1154431170 18:14309718-14309740 AAAAATGCACAGGTACAGCTTGG + Intergenic
1154432954 18:14322462-14322484 AAAGATGCACAGGAACAGCTTGG + Intergenic
1154433847 18:14329023-14329045 AAAGATGCACAGGTACAGCTTGG + Intergenic
1155707858 18:28838375-28838397 AAAGAGGCCAAGGTACAGCTTGG - Intergenic
1155809067 18:30208574-30208596 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1156154723 18:34287953-34287975 AAAGGGCCCCAGGTACAGCTGGG - Intergenic
1156736227 18:40263121-40263143 AAAGGACCCCAGGTACAGCTTGG + Intergenic
1156892338 18:42204749-42204771 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1157659890 18:49431821-49431843 GATGATGCACATGGACAGCTGGG + Intronic
1158129723 18:54139487-54139509 AAAGAGGCCAAGGTACAGCTTGG + Intergenic
1159282933 18:66310556-66310578 AAAGAAGCCAAGGTACAGCTTGG - Intergenic
1159508010 18:69360694-69360716 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1161927292 19:7310738-7310760 AAAAATACACACATACAGCTGGG - Intergenic
1163056817 19:14726162-14726184 AAAGGGGCCCAGGTATAGCTTGG - Intronic
1165202488 19:34156537-34156559 AGAAATGAACAGGTACAGGTTGG + Intergenic
1166197241 19:41215263-41215285 AAAGATGGACAGGTGGTGCTGGG - Intergenic
1166900605 19:46058778-46058800 AAAGGGGCCAAGGTACAGCTGGG - Intronic
1168039999 19:53750725-53750747 AGAGATACACAAGTACAGGTGGG - Intergenic
1168358610 19:55718975-55718997 AAAGATACAGATGTGCAGCTGGG - Intronic
1202638700 1_KI270706v1_random:63415-63437 AAAGATGCACAGGTACAGCTTGG - Intergenic
925393115 2:3512512-3512534 AAAAGGGCCCAGGTACAGCTTGG + Intronic
925490853 2:4391071-4391093 AAAGAGCCCCAAGTACAGCTTGG - Intergenic
925821173 2:7801218-7801240 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
926629615 2:15124703-15124725 AAAGGGCCCCAGGTACAGCTTGG + Intergenic
926868958 2:17391508-17391530 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
926938920 2:18115027-18115049 AAAGGGGCCAAGGTACAGCTTGG + Intronic
927302813 2:21535840-21535862 AAAGGAGCCCAGGAACAGCTCGG + Intergenic
927438234 2:23088768-23088790 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
928504269 2:31933404-31933426 AAAGAGGTACAGGTACAGAAAGG + Intronic
928804369 2:35132668-35132690 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
928983740 2:37160320-37160342 AAACAAGCACAGGGATAGCTGGG - Intergenic
929612806 2:43284394-43284416 AAAGGGGCCAAGGTACAGCTCGG + Intronic
929726119 2:44429412-44429434 AAAGAGATACAGGTCCAGCTAGG - Intronic
930129485 2:47834846-47834868 AAAGGTGCACATGTAAAGCCAGG - Exonic
930558502 2:52929961-52929983 AGAGGGGCAAAGGTACAGCTTGG - Intergenic
930812898 2:55561142-55561164 AAAGGAGCCAAGGTACAGCTTGG + Intronic
930960149 2:57251592-57251614 AAAGGAGCCAAGGTACAGCTTGG - Intergenic
931140406 2:59451941-59451963 AAGCCAGCACAGGTACAGCTTGG + Intergenic
932513910 2:72325415-72325437 AAAGAGGCAAAAGTACAGTTAGG - Intronic
933085092 2:78046006-78046028 AAAGATGCCAAGGTACAGCTCGG + Intergenic
933539080 2:83616084-83616106 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
933864165 2:86500704-86500726 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
934054980 2:88243915-88243937 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
934491820 2:94766345-94766367 AAAGATGCACAGGTACAGCTTGG - Intergenic
934492268 2:94769491-94769513 AAAGATGCACAGGCACAGCTTGG - Intergenic
934493683 2:94779740-94779762 AAAGATGTACAGGTACAGCTTGG - Intergenic
934494159 2:94782933-94782955 AAAGATGCACAGGTACAGCTTGG - Intergenic
936788537 2:116123956-116123978 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
936814679 2:116445145-116445167 AAAGGTGCAAAGGTACAACTTGG - Intergenic
936837231 2:116723070-116723092 AAAGAGGGCAAGGTACAGCTTGG - Intergenic
937003669 2:118491371-118491393 GAAAATGCAGAGGTACAGCATGG + Intergenic
937427628 2:121813373-121813395 AAAGGGGCCAAGGTACAGCTCGG + Intergenic
937730346 2:125222690-125222712 AAAGAGGCCAAGGTAGAGCTTGG - Intergenic
938165361 2:129021223-129021245 AAAGGGGCTAAGGTACAGCTTGG + Intergenic
938280120 2:130057854-130057876 AATGATGCACAGGTACAGCTTGG - Intergenic
938331077 2:130448569-130448591 AATGATGCACAGGTACAGCTTGG - Intergenic
938358871 2:130672934-130672956 AATGATGCACAGGTACAGCTTGG + Intergenic
938435264 2:131279587-131279609 AATGATGCACAGGTACAGCTTGG + Intronic
938718179 2:134039973-134039995 AAAGGGGCAAAGGTACAGCTTGG - Intergenic
938814036 2:134881523-134881545 AAAGATGTAGAGGTACAGAAGGG - Intronic
939125374 2:138171937-138171959 AAAGCGGCCCAGGTACAGCTTGG + Intergenic
939152298 2:138487318-138487340 ACAGATGCAGAGATACAGGTAGG - Intergenic
939370868 2:141298598-141298620 AAAGATGCACAGGAATGTCTGGG - Intronic
939506386 2:143052571-143052593 AAAGGGGCCAAGGTACAGCTTGG + Exonic
939835546 2:147125486-147125508 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
939847808 2:147269038-147269060 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
940288905 2:152058936-152058958 AAAGGGGCGAAGGTACAGCTTGG + Intronic
940547185 2:155102534-155102556 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
940729813 2:157375739-157375761 AAAGGGGCCCAGGTACAGCTTGG - Intergenic
941510125 2:166397167-166397189 AAAGAAGCACATGTACATCTTGG - Intergenic
942111532 2:172687699-172687721 AAATGTCCACAGTTACAGCTGGG + Intergenic
942601326 2:177643854-177643876 AAAGGGGCCAAGGTACAGCTTGG + Intronic
942950067 2:181712158-181712180 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
943271552 2:185811791-185811813 AAAGGGGCCCAGTTACAGCTTGG + Intronic
943313210 2:186353358-186353380 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
943776727 2:191774282-191774304 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
943788154 2:191901378-191901400 AAAGAGGCCAAGGTACAGCTTGG + Intergenic
944038294 2:195324412-195324434 AAAGATCATCAGGTACATCTTGG + Intergenic
944106359 2:196083600-196083622 AAAGGGGCCAAGGTACAGCTCGG + Intergenic
944371207 2:198985639-198985661 AAAGGGGCAAAGGTACAGCTTGG - Intergenic
945777133 2:214119132-214119154 AAAGATTCACAGAAACAGATAGG + Intronic
946317160 2:218923941-218923963 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
946544005 2:220716425-220716447 AAAGAAGCAAAGGTACAGCATGG - Intergenic
947952106 2:234157094-234157116 AAAGATGCACAGAAACTGTTTGG - Intergenic
948127734 2:235577014-235577036 GAAGATGCAGAGGTAGAGTTTGG - Intronic
948209869 2:236185001-236185023 AACGGGGCCCAGGTACAGCTTGG + Intergenic
948323407 2:237090907-237090929 AAGATTGCACAGGTACAGCAGGG + Intronic
1169322557 20:4645470-4645492 AAAGTGGCCCAGGTACAGCTTGG - Intergenic
1169609663 20:7364677-7364699 AAAGAGGCCAAGGTACAGCTTGG + Intergenic
1170481877 20:16774238-16774260 AAAGGTCCCCAGGTACAGCTTGG + Intergenic
1170538996 20:17369499-17369521 AAAGATGCACACGTACTCATAGG + Intronic
1170643898 20:18179550-18179572 AAAGGGGCCAAGGTACAGCTCGG - Intronic
1170918458 20:20652294-20652316 AAAGATGAACAGGTGCAGTTTGG - Intronic
1171358991 20:24573388-24573410 AAAGCAGCACAGGCAAAGCTGGG - Intronic
1171883906 20:30637708-30637730 AAAGATGCACAGGTAGAGCTTGG - Intergenic
1171885292 20:30647535-30647557 AAAGATGTACAGGTACAGCTTGG - Intergenic
1172381367 20:34495401-34495423 ATAGATGCACAAGTACAGATCGG - Intronic
1174561605 20:51434476-51434498 AAAGGTGGACAGGAACAGCCAGG - Intronic
1174842570 20:53914027-53914049 AAAGATAGATAGGTACAGCCAGG - Intergenic
1175204363 20:57300541-57300563 AAAGCTGCAGAGGTACAGTCGGG - Intergenic
1176657723 21:9602717-9602739 AAAGGAGCCAAGGTACAGCTTGG - Intergenic
1176843188 21:13856700-13856722 AAAGATGCACAGCTACAGCTTGG - Intergenic
1176844097 21:13863294-13863316 AAAGATGCACAGGTACAGCCTGG - Intergenic
1176845876 21:13876046-13876068 AAAGATGCACAGCTACAGCTTGG - Intergenic
1176846775 21:13882617-13882639 AAAGATGCACATGTACAGCTTGG - Intergenic
1176848611 21:13895601-13895623 AAAGATGCACAGCTACAGCTTGG - Intergenic
1176849543 21:13902233-13902255 AAAGATGCACAGGTACAGCTTGG - Intergenic
1177169591 21:17640651-17640673 AAAGGGGCTAAGGTACAGCTTGG - Intergenic
1177339791 21:19784019-19784041 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
1177402456 21:20623530-20623552 AAAGGGGTCCAGGTACAGCTTGG - Intergenic
1177496158 21:21894869-21894891 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1178224509 21:30699810-30699832 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1178338593 21:31766165-31766187 AAAGGGGCCAAGGTACAGCTCGG + Intergenic
1179144286 21:38753359-38753381 AGAGAGGCACAGGCACAGATTGG - Intergenic
1179527913 21:41995856-41995878 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1180019374 21:45111852-45111874 AAAGAAGCACAGGTGTTGCTGGG + Intronic
1180363268 22:11918474-11918496 AAAGATGCACAGGTAAACTTGGG + Intergenic
1180685708 22:17664800-17664822 AAAGGGGCCAAGGTACAGCTCGG - Intronic
1180718650 22:17890280-17890302 AAAGCAGCACAGGGACAGCGCGG - Intronic
1180950077 22:19716988-19717010 AGGGATGCACTGGTAGAGCTGGG + Intronic
1181377295 22:22469690-22469712 AAAGATACACAGACACAGGTAGG - Intergenic
1181727565 22:24822063-24822085 AGAGATGAACAGGTAGAGCATGG - Intronic
1182815159 22:33155918-33155940 AAAGGGGCCAAGGTACAGCTCGG + Intergenic
1184968737 22:48000059-48000081 AAGGATGCTAAGGTACAGTTAGG - Intergenic
949588188 3:5464387-5464409 AAAGATACAAAGTTATAGCTTGG - Intergenic
949612278 3:5715176-5715198 AAAGAGCCCCAAGTACAGCTTGG + Intergenic
949662194 3:6292042-6292064 AAAGGGGCAAAGGTACAGCTTGG - Intergenic
949692993 3:6662238-6662260 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
950412195 3:12846257-12846279 AAAGGGGCCAAGGTACAGCTTGG + Intronic
951058241 3:18173151-18173173 AAAAGGGCAAAGGTACAGCTTGG - Intronic
951446167 3:22782729-22782751 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
951920849 3:27852722-27852744 AAAGGAGCCAAGGTACAGCTTGG - Intergenic
951931348 3:27970574-27970596 AGAGATGCAGAGGTAGGGCTTGG + Intergenic
952188159 3:30993108-30993130 AAAGGGGCCCAGTTACAGCTCGG - Intergenic
952202670 3:31147631-31147653 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
952435267 3:33267187-33267209 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
953184954 3:40629277-40629299 AAAGGGGCCTAGGTACAGCTTGG + Intergenic
955689668 3:61578778-61578800 AGGGATGCAAAGGCACAGCTGGG + Intronic
955826282 3:62951329-62951351 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
957105669 3:75883771-75883793 AAAAAGGCCAAGGTACAGCTTGG - Intergenic
957148737 3:76457852-76457874 AAAGGGGCCAAGGTACAGCTTGG - Intronic
957160314 3:76601562-76601584 AAAGGGGCCAAGGTACAGCTTGG - Intronic
957765748 3:84621928-84621950 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
957870331 3:86083279-86083301 AAAGAGGCCAATGTACAGCTTGG - Intergenic
958065927 3:88544911-88544933 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
958067606 3:88563927-88563949 AAAAAGGCCAAGGTACAGCTTGG - Intergenic
958128365 3:89386391-89386413 AAAGAGGCCAAGGTATAGCTTGG + Intronic
958154069 3:89730592-89730614 AAAGGGGCCAAGGTACAGCTCGG + Intergenic
958582545 3:96045177-96045199 AAAGAGGCTAAGGTACAGTTTGG - Intergenic
958604348 3:96338890-96338912 AAAGGGGCCAAGGTACAGCTCGG + Intergenic
958672193 3:97219526-97219548 AAAGGGGCCAAGGTACAGCTTGG - Intronic
958710207 3:97708805-97708827 AAAGAGGCCAAGGTACAGCTCGG + Intronic
958887189 3:99739629-99739651 AAAGGGGCCAAGGTACAGCTTGG - Intronic
958893459 3:99805249-99805271 AAAGGGGCCCAGGTACAGCTTGG - Intergenic
959183195 3:103008047-103008069 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
959742580 3:109737571-109737593 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
959769195 3:110072312-110072334 AAAGAGGGCCAGGTACAGCTTGG + Intergenic
959851790 3:111096682-111096704 AAAGTGGCCAAGGTACAGCTCGG + Intronic
960150638 3:114245588-114245610 AGAGGTGCCCAGGTACAGCTTGG + Intergenic
961029722 3:123591053-123591075 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
962343643 3:134604759-134604781 CAGGATGCACACATACAGCTTGG - Intronic
963058211 3:141204861-141204883 AATGAGGTACAGGTACAGCTTGG - Intergenic
963071031 3:141305479-141305501 AAGGATGCACAGGGGCAACTGGG + Intergenic
963572783 3:147018245-147018267 ACACATACACAGGTACATCTTGG - Intergenic
963777340 3:149452386-149452408 AAAGGGGCCCAGGTAGAGCTTGG - Intergenic
963878343 3:150501340-150501362 AAAGAGGCCAAGGCACAGCTTGG - Intergenic
964026457 3:152080120-152080142 AAAGAGGCCAAGGTACAGCTTGG - Intergenic
964271236 3:154958734-154958756 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
964341991 3:155717596-155717618 AAAGAGCCTCAGATACAGCTTGG - Intronic
964457016 3:156879783-156879805 AAAGGCGCCAAGGTACAGCTCGG + Intronic
964638694 3:158885611-158885633 CAAGGGCCACAGGTACAGCTTGG + Intergenic
965057809 3:163744514-163744536 AAAGGGGCACAGGTACATCTTGG - Intergenic
965074922 3:163963967-163963989 AAAAGGGCCCAGGTACAGCTTGG + Intergenic
965349621 3:167597219-167597241 AAAGGGGCCAAGGTACAGCTAGG + Intronic
965662106 3:171052798-171052820 AAAGAGGCCAAAGTACAGCTTGG + Intergenic
965670226 3:171140388-171140410 GAGCATGAACAGGTACAGCTGGG - Exonic
965838801 3:172880467-172880489 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
965869950 3:173253177-173253199 AAAAAGGCTCATGTACAGCTTGG - Intergenic
965926596 3:173988004-173988026 AAAGATGCATAGCTACATTTTGG + Intronic
965957615 3:174389723-174389745 AAAGGGGCCCAGGTAGAGCTTGG - Intergenic
966241357 3:177758040-177758062 AAAGTGGCCAAGGTACAGCTTGG - Intergenic
966320367 3:178695170-178695192 AAAGGGGCCAAGGTACAGCTAGG - Intronic
966739139 3:183215785-183215807 GAAGATGCCAAGGGACAGCTTGG + Intronic
967260246 3:187634734-187634756 AAAGGGGCCCAGGTACAGCTTGG - Intergenic
967509434 3:190292333-190292355 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
967564641 3:190959418-190959440 AAAGAGACCAAGGTACAGCTTGG + Intergenic
968014697 3:195319057-195319079 AAAGAGGCCAAGGTACAGCTCGG + Intronic
969163218 4:5279830-5279852 AAAGGGGCAAAGGTACAGCTTGG - Intronic
970073828 4:12195358-12195380 AAAGGGGCCCAGATACAGCTTGG - Intergenic
970307979 4:14752701-14752723 AAAGAGGCCAAGGTACAGCTTGG - Intergenic
970382134 4:15518772-15518794 AAAGAAGCCAAGGTACAACTCGG - Intronic
970678289 4:18477435-18477457 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
970977363 4:22057136-22057158 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
971010655 4:22430910-22430932 AAAGGGGCCAAGGTACAGCTTGG + Intronic
971069974 4:23080253-23080275 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
971545477 4:27880143-27880165 AAAGGGGCCCAGGTACAGCTTGG - Intergenic
971546268 4:27891042-27891064 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
971733531 4:30416834-30416856 AAAGGGGCCAAGGTACAGCTCGG + Intergenic
971875313 4:32300926-32300948 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
972190361 4:36584067-36584089 TAAGATGCACAGAGACAGCGTGG + Intergenic
972744555 4:41920811-41920833 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
972760638 4:42100115-42100137 ACAGATGCAAAGTTACAGTTAGG - Intergenic
972829907 4:42802836-42802858 AAAGGGGCCCAGGTACAACTTGG - Intergenic
973367569 4:49219979-49220001 AAAGATGCACAGGTACAGCTTGG - Intergenic
973368947 4:49229803-49229825 AAAGACATACAGGTACAGCTCGG - Intergenic
973392096 4:49565612-49565634 AAAGACATACAGGTACAGCTCGG + Intergenic
973393484 4:49575453-49575475 AAAGATGCACAGGTACAGCTTGG + Intergenic
973613326 4:52657754-52657776 ATAGCTGCACAGGTACTGGTTGG - Intronic
973998526 4:56485306-56485328 AAAGTTGGACAGGTACAATTAGG + Intronic
974573692 4:63689020-63689042 AAAGGAGCCAAGGTACAGCTGGG + Intergenic
974615732 4:64278715-64278737 AAGGATACAAAGTTACAGCTTGG - Exonic
974748138 4:66102753-66102775 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
974897590 4:67957926-67957948 AAAGAGGCCAAGCTACAGCTTGG + Intronic
975727431 4:77305721-77305743 ACTGATGCCCAGGTGCAGCTGGG - Intronic
975729246 4:77321367-77321389 AAAGAGGCCAAGGTACAGCTTGG - Intronic
976491573 4:85676733-85676755 AAAGATGAATGGGTACTGCTTGG - Intronic
976672943 4:87674040-87674062 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
977050116 4:92119211-92119233 AAAGGGTCCCAGGTACAGCTTGG + Intergenic
977393912 4:96448579-96448601 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
978153406 4:105463724-105463746 AAAGGGGCCAAGGTACAGCTTGG + Intronic
978856539 4:113400762-113400784 AAAGGGGCCAAGGTACAGCTCGG + Intergenic
979137494 4:117127929-117127951 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
979805147 4:124961478-124961500 AAAGGGGCAAAGGTACAGCTTGG - Intergenic
979824909 4:125220954-125220976 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
980065734 4:128186882-128186904 AAAGGGGCCCAGATACAGCTTGG + Intronic
980266545 4:130524144-130524166 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
980293085 4:130870502-130870524 AAAGAGGTCAAGGTACAGCTTGG + Intergenic
980324460 4:131323973-131323995 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
980346828 4:131633142-131633164 AAAGGGGCAAAGGTGCAGCTTGG + Intergenic
981121017 4:141051126-141051148 AAAGGGGCCAAGGTACAGCTTGG - Intronic
981148184 4:141350129-141350151 AAAGATGCAGATGAACAGCCAGG + Intergenic
981842940 4:149133495-149133517 AAAGAAGCCCAGTTACAGCTTGG + Intergenic
982075994 4:151737759-151737781 AAAGGGGCAAAGGTACAGCTTGG + Intronic
982279124 4:153665976-153665998 AAAGGAGCCAAGGTACAGCTTGG + Intergenic
982390920 4:154863045-154863067 AAAGGGCCACTGGTACAGCTTGG - Intergenic
982524990 4:156466919-156466941 AAAGAGGCCAAGGTACAGCTTGG - Intergenic
983015519 4:162607837-162607859 AAAGGGGCTCAGGTACAACTTGG + Intergenic
983105633 4:163682576-163682598 AAAGGGGCCAAGGTACAGCTTGG + Intronic
983132866 4:164043410-164043432 AAAGTGGTAAAGGTACAGCTTGG - Intronic
983264873 4:165498001-165498023 AAAGGTTAACAGATACAGCTCGG + Exonic
983874738 4:172862977-172862999 AAAGGGGCCAAGGTACAGCTTGG + Intronic
983968513 4:173843609-173843631 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
985044359 4:185925270-185925292 AAATATGTACATGTACAGCTGGG + Intronic
985304296 4:188521934-188521956 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1202766038 4_GL000008v2_random:149274-149296 AAAGATGCACAGGTACAGCTTGG - Intergenic
985683154 5:1267216-1267238 AAAGATGCACAGGAAAAACCCGG + Intronic
985809541 5:2073010-2073032 AAAGGTCCCCAGGTATAGCTTGG + Intergenic
985887363 5:2689909-2689931 AAGGATGGACAGGGACGGCTGGG + Intergenic
986144118 5:5061049-5061071 AAAGATTCTGAGGTACTGCTTGG + Intergenic
986455316 5:7912435-7912457 AAAGAGGCCAAGGTACAGCTTGG - Intergenic
986869248 5:12028052-12028074 AAAGCGGCCAAGGTACAGCTTGG - Intergenic
986916334 5:12625085-12625107 AAAAGGGCCCAGGTACAGCTTGG + Intergenic
987097944 5:14566535-14566557 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
987252258 5:16111895-16111917 AAAGAAGCCAAGGTACAGCTTGG + Intronic
987289539 5:16495546-16495568 AAAGAGGCCAAGGTACAGCTCGG + Intronic
987435237 5:17885635-17885657 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
987773570 5:22336560-22336582 AAAGTGGCCAAGGTACAGCTTGG + Intronic
988080651 5:26410712-26410734 AAAGGAGCCAAGGTACAGCTTGG + Intergenic
988804486 5:34727637-34727659 AAAGGGGCCAAGGTACAGCTTGG + Intronic
989229093 5:39066253-39066275 AAAGGGGCCCAGGTACAGTTCGG - Intronic
989726873 5:44597475-44597497 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
990701082 5:58475510-58475532 AAAGGTGCCAAGGTACAGCTTGG - Intergenic
990939547 5:61188126-61188148 AAAGAAGTCAAGGTACAGCTCGG + Intergenic
991116869 5:62964516-62964538 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
991409364 5:66331425-66331447 AAACAGGCCAAGGTACAGCTTGG + Intergenic
991457519 5:66820491-66820513 AATGATGCACAGCTAACGCTGGG - Intronic
991535896 5:67669158-67669180 AAAGCGGCCAAGGTACAGCTTGG + Intergenic
991776340 5:70089406-70089428 AAAGGGGCCTAGGTACAGCTTGG + Intergenic
991855627 5:70964853-70964875 AAAGGGGCCTAGGTACAGCTTGG + Intergenic
991869639 5:71097631-71097653 AAAGGGGCCTAGGTACAGCTTGG + Intergenic
993067132 5:83114059-83114081 AAACAGGCAAAGGTACAGATCGG - Intronic
993198556 5:84782291-84782313 AAAGAGCCCCAGGTATAGCTTGG - Intergenic
993267110 5:85740273-85740295 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
994689546 5:102999751-102999773 AAAGAGGCCAAGGTATAGCTTGG - Intronic
994749564 5:103721306-103721328 AAAGGCGCCAAGGTACAGCTTGG - Intergenic
994840911 5:104923955-104923977 GAAGAGGCCCAGGTACAGCTTGG + Intergenic
995113495 5:108453855-108453877 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
995556905 5:113338921-113338943 AAACATGCACAGTCACTGCTAGG - Intronic
995703605 5:114962125-114962147 AAACAGGCCAAGGTACAGCTTGG - Intergenic
995925531 5:117369296-117369318 AAAGGAGCCAAGGTACAGCTTGG + Intergenic
996126120 5:119727499-119727521 AAAGAGGCCAAGGTACAACTTGG + Intergenic
996236912 5:121141676-121141698 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
996701044 5:126450723-126450745 AAAGGGGCCCAGGTACAGCTCGG + Intronic
997036855 5:130202953-130202975 AAAGGTGCCAACGTACAGCTTGG - Intergenic
997086456 5:130806034-130806056 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
997102092 5:130980640-130980662 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
997274640 5:132574354-132574376 AAAGAAGCCAAGGTACAGCTTGG - Intronic
997692845 5:135838658-135838680 AAAGGGGCCAAGGTACAGCTTGG + Intronic
998759050 5:145411936-145411958 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
999504434 5:152180213-152180235 AAAGCAGCCAAGGTACAGCTCGG - Intergenic
999755885 5:154664006-154664028 AAAGGGCCCCAGGTACAGCTTGG - Intergenic
1000270636 5:159680122-159680144 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1000496366 5:161989803-161989825 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1000648450 5:163785869-163785891 AAAGAGGCCAATGTACAGCTTGG - Intergenic
1000777891 5:165442284-165442306 AAAGGGGCCGAGGTACAGCTTGG - Intergenic
1000945056 5:167412215-167412237 AAAGAGGAACAGGAGCAGCTAGG + Intronic
1002794045 6:456505-456527 AAAGGGGCCCAGGTATAGCTTGG - Intergenic
1003230050 6:4243638-4243660 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1003690184 6:8346326-8346348 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1003798310 6:9630815-9630837 AACGAGGCCAAGGTACAGCTTGG + Intronic
1004351561 6:14894562-14894584 AAGAATGCTCAGGAACAGCTGGG + Intergenic
1004430214 6:15536446-15536468 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1004759559 6:18651351-18651373 AAAGATGAAGATGAACAGCTTGG - Intergenic
1005386275 6:25288249-25288271 AAACATACTAAGGTACAGCTGGG + Intronic
1005435157 6:25801954-25801976 GAACATCCACAGGTAGAGCTTGG + Intronic
1005604999 6:27467691-27467713 AAAGCTGGAGAGGCACAGCTAGG + Intronic
1005921705 6:30407510-30407532 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1005984149 6:30860068-30860090 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1006693238 6:35908817-35908839 AAAGGGGCTAAGGTACAGCTTGG + Intronic
1007021477 6:38526216-38526238 AAAGTGGCCAAGGTACAGCTTGG + Intronic
1007410455 6:41658361-41658383 AAAGATGGACAGCCACAGCAGGG + Intergenic
1007889283 6:45271419-45271441 AAAGAGGCCAAGGTATAGCTCGG + Intronic
1008104680 6:47428866-47428888 AAAGGGGCCCAGGTACAGCTTGG - Intergenic
1008226180 6:48919839-48919861 AAAGGGCCCCAGGTACAGCTTGG + Intergenic
1009059064 6:58375433-58375455 AAAGAGACACAGGTACTGCATGG - Intergenic
1009231782 6:61071690-61071712 AAAGAGACACAGGTACTGCATGG + Intergenic
1009309630 6:62134260-62134282 AAAGAGGCCAAGGTACAGCTTGG + Intronic
1009554774 6:65148898-65148920 AAAGGGGCCAAGGTACAGCTTGG - Intronic
1009792368 6:68419974-68419996 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1009825041 6:68856961-68856983 AAAGAAGCCAAGGTACAGCTTGG + Intronic
1010324105 6:74545008-74545030 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1010835818 6:80586522-80586544 AAAGGGGCTAAGGTACAGCTTGG + Intergenic
1010909558 6:81536678-81536700 AAAGGGGCCAAGGTACAGCTCGG - Intronic
1011011201 6:82705691-82705713 AAAGGGGCAAAGGTACAGCTTGG - Intergenic
1011041137 6:83031830-83031852 AAAGGGGCCAAGGTACAGCTCGG + Intronic
1012029199 6:94036955-94036977 AAAGACACAAAAGTACAGCTTGG + Intergenic
1012161348 6:95888870-95888892 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1012485885 6:99722338-99722360 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1012617379 6:101293527-101293549 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1012653306 6:101784298-101784320 AAAGCAGCCAAGGTACAGCTCGG + Intronic
1012811678 6:103967003-103967025 AAAGGGGCCAAGGTACAGCTAGG - Intergenic
1013829563 6:114255747-114255769 AAAGAGGCCAAGGTACAGCTTGG - Intronic
1014482464 6:121954946-121954968 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1014670722 6:124301176-124301198 AAAGGGGCCAAGGTACAGCTCGG + Intronic
1015039837 6:128703611-128703633 AAAGGAGCCAAGGTACAGCTTGG + Intergenic
1015110728 6:129588927-129588949 AAAGGGGCCAAGGTACAGCTCGG - Intronic
1015351534 6:132225504-132225526 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1015677113 6:135762468-135762490 AAAGAGACCAAGGTACAGCTTGG - Intergenic
1016128310 6:140434023-140434045 AAAGAAACCAAGGTACAGCTTGG + Intergenic
1016143656 6:140644011-140644033 AAAGGGGCCGAGGTACAGCTGGG - Intergenic
1016175220 6:141071577-141071599 AAAGGGGCAAAGGTACAGCTCGG + Intergenic
1016301894 6:142641638-142641660 AAAGATGCACAGGAATGGTTAGG - Intergenic
1016537614 6:145126270-145126292 AAAGCGGCCAAGGTACAGCTTGG + Intergenic
1017640653 6:156490700-156490722 AAAGGTGCCAAGGTACAGCTCGG + Intergenic
1018365622 6:163117051-163117073 GAGCATGCCCAGGTACAGCTAGG + Intronic
1018721559 6:166577002-166577024 AAAGGGGCCAAGGTACAGCTCGG + Intronic
1019561045 7:1657586-1657608 AGAGATGCTGAGGAACAGCTGGG + Intergenic
1022907662 7:34872212-34872234 AAAGGGGCCAAGGTACAGCTTGG - Intronic
1023477327 7:40594600-40594622 AGAGATTCACAGGTAAATCTGGG - Intronic
1023590277 7:41774145-41774167 AAACATGCACATGTACCCCTGGG + Intergenic
1024015313 7:45308298-45308320 AAAGTGGCCCAAGTACAGCTTGG + Intergenic
1024799070 7:53054993-53055015 ATGGATGCACAGTTACAGTTAGG + Intergenic
1025080647 7:55979638-55979660 AAGGAGACACAGGTATAGCTTGG - Intronic
1025721560 7:64020414-64020436 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1025971188 7:66327425-66327447 AAAAATGTATATGTACAGCTGGG + Intronic
1030108505 7:106007092-106007114 AAAGGGGCCAAGGTACAGCTCGG - Intronic
1030559115 7:111063268-111063290 AAAGGGGCCAAGGTACAGCTTGG - Intronic
1030967048 7:116005915-116005937 AAAGGGGCCAAGGTACAGCTAGG + Intronic
1031473146 7:122191321-122191343 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1031618260 7:123905798-123905820 AAAGAGGTTCAGGTACAGTTGGG - Intergenic
1031791965 7:126118047-126118069 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1031950458 7:127886364-127886386 AAACATGCACAGATACTGGTTGG + Intronic
1032366751 7:131307099-131307121 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1033597799 7:142869035-142869057 AAAGCTGGACAGGTACTGCATGG - Exonic
1033843506 7:145403697-145403719 AAAGCGGCCCATGTACAGCTTGG + Intergenic
1034468426 7:151243302-151243324 AAAGAGACCCAGGTCCAGCTGGG - Intronic
1035434681 7:158850386-158850408 AAAGATCCACAGCCACAGTTTGG + Intergenic
1035817847 8:2561048-2561070 AAGGATGCAGAGGTTCAGCGGGG - Intergenic
1036914710 8:12793793-12793815 CAAGGGGCCCAGGTACAGCTTGG - Intergenic
1037048813 8:14343005-14343027 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1037760950 8:21741214-21741236 AGAGATGCACAGGTTGAGGTTGG - Intronic
1037975616 8:23209080-23209102 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1039158998 8:34595880-34595902 AAAGAGTCCCAGGTATAGCTTGG - Intergenic
1039183734 8:34893707-34893729 AAAGATGGGCAAGGACAGCTTGG + Intergenic
1039433949 8:37546989-37547011 AAACAGGCACAGGTAGAGGTGGG - Intergenic
1040102464 8:43517926-43517948 AAAGATGCACATGTACAGCTTGG + Intergenic
1040103821 8:43527926-43527948 AAAGATGTACAGGTACAGCTTGG + Intergenic
1040644992 8:49387888-49387910 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1040863446 8:52024119-52024141 AAAGAGGCCAAGGTACAGCTTGG + Intergenic
1041682411 8:60606748-60606770 AAAAAGGCCCAGGTATAGCTTGG - Intronic
1042071642 8:64941546-64941568 AAAGTGGCAAAGGTACAGCTTGG - Intergenic
1042164870 8:65935609-65935631 AAAGAGACCAAGGTACAGCTTGG + Intergenic
1042435585 8:68760938-68760960 AAAGATTCCAAGGTAGAGCTAGG - Intronic
1042529030 8:69795962-69795984 AAAGAGTCCCAGGTACAGTTTGG - Intronic
1042992350 8:74655484-74655506 AAAGGGGCCAAGGTACAGCTCGG + Intronic
1043533650 8:81176582-81176604 AAAGGGGCACAGATACAGCTGGG - Intergenic
1043582385 8:81728679-81728701 AAAGATCCTGAGGTTCAGCTGGG - Intronic
1043779466 8:84313131-84313153 AAGGAGGCCAAGGTACAGCTCGG - Intronic
1043811979 8:84752688-84752710 AAAGGGTCCCAGGTACAGCTTGG + Intronic
1044220452 8:89663548-89663570 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1044877200 8:96681365-96681387 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1045012211 8:97968090-97968112 ACAGGGCCACAGGTACAGCTTGG - Intronic
1045067215 8:98459725-98459747 AAAGGGGCCAAGGTACAGCTCGG + Intronic
1046368640 8:113271454-113271476 AAAGGGGCCAAGGTACAGCTCGG + Intronic
1046656319 8:116899146-116899168 AAAGAGGCCAATGTACAGCTTGG + Intergenic
1046689601 8:117267794-117267816 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
1046839498 8:118841303-118841325 AAAGGGGCATAGGTACAGCCTGG + Intergenic
1047540878 8:125765006-125765028 AAAGATAGAAAAGTACAGCTAGG + Intergenic
1047940437 8:129823521-129823543 AAAGGGGCCCAGGTACAGCTTGG + Intergenic
1048839349 8:138551352-138551374 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1050125158 9:2349012-2349034 AAAGAGGCCTAGGTACAGTTTGG + Intergenic
1050447620 9:5742189-5742211 AAAGATACCCATGTAAAGCTGGG - Intronic
1050561079 9:6834867-6834889 AAAGAAGTACAGGGACAGCACGG - Intronic
1050643383 9:7693050-7693072 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1050935176 9:11386979-11387001 AAAAGGGCTCAGGTACAGCTTGG + Intergenic
1051331306 9:16027388-16027410 AGAGAGGCACTGATACAGCTGGG + Intronic
1051767467 9:20540529-20540551 AAAGGGGCCAAGGTACAGCTTGG - Intronic
1052877763 9:33580236-33580258 AAAGATGCACAGGTACAGCTTGG + Intergenic
1052878205 9:33583327-33583349 AAAGACGCACAGGTACAGCTTGG + Intergenic
1052878649 9:33586423-33586445 AAAGATGCACAGGTACAGCTTGG + Intergenic
1052879080 9:33589508-33589530 AAAGATGCACAGGTACAGCTTGG + Intergenic
1052879514 9:33592624-33592646 AAAGATGCACAGGCACAGCTTGG + Intergenic
1052879958 9:33595685-33595707 GAAAATGCACAGATGCAGCTTGG + Intergenic
1053267167 9:36723884-36723906 TAAAATGGACAGGTACTGCTAGG + Intergenic
1053371324 9:37564117-37564139 AAAGGGGCCAAGGTACAGCTTGG + Intronic
1053496015 9:38548535-38548557 GAAAATGCACAGATGCAGCTTGG - Intronic
1053496464 9:38551608-38551630 AAAGATGCACAGGCACAGCTTGG - Intronic
1053496896 9:38554711-38554733 AAAGATGCACAGGTACAGCTTGG - Intronic
1053497328 9:38557786-38557808 AAAGATGCACAGGCACAGCTTGG - Intronic
1053497779 9:38560880-38560902 AAAGACGCACAGGTACAGCTTGG - Intronic
1053498222 9:38563969-38563991 AAAGATGCACAGGTACAGCTTGG - Intronic
1053625605 9:39867720-39867742 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1053663403 9:40300292-40300314 AAAGATGTACAGGTACAGCTTGG + Intronic
1053663915 9:40304192-40304214 ACAGATACAAAGGTACATCTTGG + Intronic
1053664346 9:40307136-40307158 AAAGATGCACAGGTACAGCTTGG + Intronic
1053664870 9:40310391-40310413 AAAGATGCACAGGTACAGCTTGG + Intronic
1053666183 9:40319516-40319538 AAAGATGCACAGGTACAGCTTGG + Intronic
1053893408 9:42718860-42718882 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1053913418 9:42927604-42927626 AAAGATGCACAGGTACAGCTTGG + Intergenic
1053913914 9:42930833-42930855 AAAGATGCACAGGTACAGCTTGG + Intergenic
1053915327 9:42941466-42941488 AAAGATGCACAGGTACAGCTCGG + Intergenic
1053915767 9:42944563-42944585 AAAGATGCACAGTTACAGCTTGG + Intergenic
1054218283 9:62382981-62383003 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1054375526 9:64446526-64446548 AAAGATGTACAGGTACAGCTTGG + Intergenic
1054376041 9:64450426-64450448 ACAGATACAAAGGTACATCTTGG + Intergenic
1054377336 9:64459544-64459566 AAAGATGCACAGGTACAGCTTGG + Intergenic
1054518426 9:66056767-66056789 AAAGATGCACAGGTACAGCTTGG - Intergenic
1054519744 9:66065893-66065915 AAAGATGCACAGGTACAGCTTGG - Intergenic
1054520268 9:66069149-66069171 AAAGATGCACAGGTACAGCTTGG - Intergenic
1054520698 9:66072093-66072115 ACAGATACAAAGGTACATCTTGG - Intergenic
1054521211 9:66075993-66076015 AAAGATGTACAGGTACAGCTTGG - Intergenic
1056432846 9:86545822-86545844 AAAGATACACGTTTACAGCTGGG - Intergenic
1056586124 9:87928346-87928368 GAAAATGCACAGATGCAGCTTGG - Intergenic
1056610758 9:88124597-88124619 GAAAATGCACAGATGCAGCTTGG + Intergenic
1057161394 9:92890846-92890868 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057675944 9:97136053-97136075 GAAAATGCACAGATGCAGCTTGG - Intergenic
1057676805 9:97142268-97142290 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057677244 9:97145365-97145387 AAAGATGCACAGGTACAGCTTGG - Intergenic
1057677687 9:97148453-97148475 AAAGATGCACAGGTACAGCTTGG - Intergenic
1058309721 9:103485424-103485446 AAAGGGGCCAAGGTACAGCTAGG + Intergenic
1059045457 9:110861653-110861675 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1059082604 9:111266114-111266136 AAAGAGGCCAAGGTACAGGTTGG - Intergenic
1059517538 9:114909701-114909723 AAAGATAGACAGGTGCAGCTGGG - Intronic
1059601400 9:115783233-115783255 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1059656135 9:116359376-116359398 ACAGATGCACAGGCACAGAGAGG + Intronic
1059917288 9:119117842-119117864 AATGGGGCCCAGGTACAGCTTGG + Intergenic
1060622695 9:125082196-125082218 AAAGGGGCCGAGGTACAGCTTGG + Intronic
1061173804 9:128979204-128979226 AAAGATAGACTGGTTCAGCTAGG + Intronic
1062419741 9:136474458-136474480 AAAGATGCCCAGGGCCAGCCTGG - Exonic
1203546787 Un_KI270743v1:134163-134185 AAAGATGCACAGGTACAGCTTGG - Intergenic
1203635451 Un_KI270750v1:106291-106313 AAAGGAGCCAAGGTACAGCTTGG - Intergenic
1187109803 X:16285329-16285351 AAAAATCCACAGAGACAGCTCGG + Intergenic
1187667412 X:21628636-21628658 AAAGGGGCCAAGGTACAGCTTGG - Intronic
1187894440 X:23967095-23967117 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
1188016412 X:25112208-25112230 AAAGGGCCCCAGGTACAGCTTGG - Intergenic
1188106816 X:26156422-26156444 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
1188158902 X:26776342-26776364 AGAGGTGCCAAGGTACAGCTTGG + Intergenic
1188660415 X:32751849-32751871 AAAGGGGCCGAGGTACAGCTTGG + Intronic
1188807857 X:34613876-34613898 AAAGAGGGCAAGGTACAGCTTGG - Intergenic
1189028843 X:37428989-37429011 AAAGGGGCTAAGGTACAGCTTGG - Intronic
1189431416 X:40950627-40950649 AAAGGGGCCCAGGTACAGCTTGG - Intergenic
1189869659 X:45368969-45368991 AAAGGGGCCCAGGTACAGCTTGG + Intergenic
1189886066 X:45546024-45546046 AAAGGGGCCCAGGTACAGCTTGG + Intergenic
1191211472 X:57889499-57889521 AAAGGGGCCAAGGTACAGCTCGG - Intergenic
1192544636 X:72003461-72003483 CAAAATGCTCAGGTTCAGCTGGG + Intergenic
1192689679 X:73349255-73349277 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1193210497 X:78801787-78801809 AAAGGGGCAAAGGTACAGCTTGG + Intergenic
1193266619 X:79479284-79479306 AAAGCTGCACACCTACAGCAAGG - Intergenic
1193279347 X:79628577-79628599 AAAGATACCAAGGTACAGCTTGG + Intergenic
1193320386 X:80114800-80114822 AAAGAGGCCAAGGTACAGCTCGG + Intergenic
1193408721 X:81137107-81137129 ACAGATCCACAAGTATAGCTGGG - Intronic
1193547299 X:82845874-82845896 AAAGGGGCCTAGGTACAGCTTGG + Intergenic
1193585660 X:83318531-83318553 AAAGGAGCCAAGGTACAGCTTGG + Intergenic
1193727012 X:85053373-85053395 AGAGATGCAGAGGTTCATCTTGG - Intronic
1193813752 X:86082077-86082099 AAAGGGGCCAAGGTACAGCTAGG - Intergenic
1194352713 X:92840267-92840289 AAAGAGGCCAAGGTACATCTCGG - Intergenic
1194418085 X:93637892-93637914 AAACAGGCTCAGGTATAGCTTGG + Intergenic
1194499161 X:94658726-94658748 AAAGGGGCAAAGGTAAAGCTTGG + Intergenic
1194534269 X:95086192-95086214 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1194548906 X:95272586-95272608 AAAGGGGCAAAGGTATAGCTTGG - Intergenic
1194554240 X:95337700-95337722 AAAGAGGCCAAGGAACAGCTTGG - Intergenic
1194842375 X:98759591-98759613 AAATATGCACAAGAACAGATTGG + Intergenic
1194856226 X:98932775-98932797 AAAGGGACACAGGTACAGCTTGG + Intergenic
1194864900 X:99053829-99053851 AAAGAGGCCAATGTACAGCTTGG + Intergenic
1194895267 X:99432459-99432481 AAAGGGGCCCAGGTACAGCTCGG + Intergenic
1194910107 X:99631092-99631114 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1195154531 X:102109938-102109960 AAAGGGGCTAAGGTACAGCTTGG + Intergenic
1195525931 X:105889736-105889758 AAAGGGGCCAAGGTACAGCTTGG - Intronic
1195536293 X:106012716-106012738 AAAGGGGCCAAGGTACAGCTCGG + Intergenic
1195551824 X:106180233-106180255 AGAGATGCCCAGGGAAAGCTGGG - Intronic
1196099095 X:111829622-111829644 AAAGGTGCCCAGGTACAGCTTGG + Intronic
1196287506 X:113899489-113899511 AAGAATGAACAAGTACAGCTTGG - Intergenic
1197074768 X:122341171-122341193 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1197094309 X:122574939-122574961 AAAGGGGCCCAGGTACAGCTTGG - Intergenic
1197109578 X:122756587-122756609 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1197181292 X:123539523-123539545 AAAGATGCACTGGTGAAGGTAGG - Intergenic
1197349806 X:125370000-125370022 AAAGAGGCCAAGGTACAACTGGG - Intergenic
1197372942 X:125646799-125646821 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1197385483 X:125796218-125796240 AAAGGGGCCCAGGTAGAGCTGGG + Intergenic
1197473419 X:126891034-126891056 CAAGGGGCCCAGGTACAGCTTGG - Intergenic
1197569499 X:128131646-128131668 AAAGGGGCAAAGGTACAACTTGG + Intergenic
1198091547 X:133335985-133336007 GAAGTTGCACAGAGACAGCTGGG - Intronic
1198913412 X:141638621-141638643 AAAGGGGCCAAGGTACAGCTTGG - Intronic
1198951707 X:142079692-142079714 AAATGTGCCAAGGTACAGCTTGG - Intergenic
1198991039 X:142515105-142515127 AAAGAGTCCAAGGTACAGCTTGG - Intergenic
1199020298 X:142870504-142870526 AAAGTGGCAAAGGTACAGCTCGG + Intergenic
1199071146 X:143476952-143476974 AAAGTGGCCAAGGTACAGCTTGG + Intergenic
1199220346 X:145309667-145309689 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1199291130 X:146105977-146105999 AAAAAGGCCAAGGTACAGCTCGG - Intergenic
1199317751 X:146400538-146400560 AAAGGGGCCAAGGTACAGCTCGG + Intergenic
1199346515 X:146747025-146747047 AAAGGGGCCAAGGTACAGCTTGG - Intergenic
1199357161 X:146875709-146875731 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1199580758 X:149357851-149357873 AAAGGGGCCAAGGTACAGCTTGG + Intergenic
1199869770 X:151888022-151888044 AAAGAGGCCAAGGTACAGCTTGG + Intergenic
1199928409 X:152493975-152493997 AAAGAGGCCAAGGTACAGCTCGG + Intergenic
1200141634 X:153905527-153905549 AGGGATGCCCAGGCACAGCTGGG - Exonic
1200661018 Y:5957009-5957031 AAAGAGGCCAAGGTACATCTCGG - Intergenic
1201366330 Y:13210793-13210815 AAAGATGCAGAGTGGCAGCTGGG - Intergenic
1201590035 Y:15604528-15604550 AAAGGAGCAAAAGTACAGCTTGG - Intergenic