ID: 1053666875

View in Genome Browser
Species Human (GRCh38)
Location 9:40323202-40323224
Sequence AGAGACTGTCCCTGCTGTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053666872_1053666875 -6 Left 1053666872 9:40323185-40323207 CCCTGAAGGTAAATGGAAGAGAC 0: 4
1: 0
2: 4
3: 24
4: 244
Right 1053666875 9:40323202-40323224 AGAGACTGTCCCTGCTGTGTGGG No data
1053666867_1053666875 30 Left 1053666867 9:40323149-40323171 CCTTGGTTGCCTTAGAGTGACAT 0: 4
1: 2
2: 12
3: 14
4: 142
Right 1053666875 9:40323202-40323224 AGAGACTGTCCCTGCTGTGTGGG No data
1053666873_1053666875 -7 Left 1053666873 9:40323186-40323208 CCTGAAGGTAAATGGAAGAGACT 0: 4
1: 0
2: 4
3: 35
4: 199
Right 1053666875 9:40323202-40323224 AGAGACTGTCCCTGCTGTGTGGG No data
1053666869_1053666875 21 Left 1053666869 9:40323158-40323180 CCTTAGAGTGACATGGATCAGTC 0: 4
1: 2
2: 3
3: 8
4: 94
Right 1053666875 9:40323202-40323224 AGAGACTGTCCCTGCTGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053666875 Original CRISPR AGAGACTGTCCCTGCTGTGT GGG Intronic
No off target data available for this crispr