ID: 1053667176

View in Genome Browser
Species Human (GRCh38)
Location 9:40324519-40324541
Sequence GAAGAGTGCTCTGGTGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 6, 1: 2, 2: 5, 3: 17, 4: 199}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053667176_1053667184 29 Left 1053667176 9:40324519-40324541 CCTGTCTCACCAGAGCACTCTTC 0: 6
1: 2
2: 5
3: 17
4: 199
Right 1053667184 9:40324571-40324593 GGGAGTCCCATTTCAGGTGTGGG No data
1053667176_1053667180 8 Left 1053667176 9:40324519-40324541 CCTGTCTCACCAGAGCACTCTTC 0: 6
1: 2
2: 5
3: 17
4: 199
Right 1053667180 9:40324550-40324572 GAGGTCTCAGGTGCTCTACAAGG No data
1053667176_1053667179 -4 Left 1053667176 9:40324519-40324541 CCTGTCTCACCAGAGCACTCTTC 0: 6
1: 2
2: 5
3: 17
4: 199
Right 1053667179 9:40324538-40324560 CTTCTGTCTGTAGAGGTCTCAGG No data
1053667176_1053667185 30 Left 1053667176 9:40324519-40324541 CCTGTCTCACCAGAGCACTCTTC 0: 6
1: 2
2: 5
3: 17
4: 199
Right 1053667185 9:40324572-40324594 GGAGTCCCATTTCAGGTGTGGGG No data
1053667176_1053667183 28 Left 1053667176 9:40324519-40324541 CCTGTCTCACCAGAGCACTCTTC 0: 6
1: 2
2: 5
3: 17
4: 199
Right 1053667183 9:40324570-40324592 AGGGAGTCCCATTTCAGGTGTGG No data
1053667176_1053667182 23 Left 1053667176 9:40324519-40324541 CCTGTCTCACCAGAGCACTCTTC 0: 6
1: 2
2: 5
3: 17
4: 199
Right 1053667182 9:40324565-40324587 CTACAAGGGAGTCCCATTTCAGG No data
1053667176_1053667181 9 Left 1053667176 9:40324519-40324541 CCTGTCTCACCAGAGCACTCTTC 0: 6
1: 2
2: 5
3: 17
4: 199
Right 1053667181 9:40324551-40324573 AGGTCTCAGGTGCTCTACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053667176 Original CRISPR GAAGAGTGCTCTGGTGAGAC AGG (reversed) Intronic
901183821 1:7359370-7359392 AAACTGTGCTCTGGTGAGGCTGG + Intronic
901572745 1:10174828-10174850 GAAGAGAGCTTTGGTGGGGCAGG + Intronic
901939357 1:12650414-12650436 GAAGAATGATCTGTTGATACAGG + Intronic
902534049 1:17108824-17108846 GAAAAGTGTTATAGTGAGACAGG + Intronic
903213432 1:21830853-21830875 GGAGAGTGCTCAGGTGAGAGTGG + Intronic
903339644 1:22645644-22645666 GAAGCGTGCTCTGGAGTGTCTGG - Intronic
903657739 1:24959367-24959389 GCAGGGTGGTCTGGGGAGACGGG + Intronic
903839168 1:26225925-26225947 GAAGAGTGATCTGGTGTGACAGG - Intergenic
904055428 1:27666900-27666922 GAAGAGAGCCCTGCTCAGACGGG - Intronic
904413529 1:30340591-30340613 GAAGAGTTCTTTGCTGAAACTGG + Intergenic
904419841 1:30384550-30384572 GATGCCTGCTCTGGTGACACAGG + Intergenic
906297214 1:44656114-44656136 GGAGAGTGCTGGGGTCAGACAGG + Intronic
906637378 1:47418077-47418099 GGGGAGTGGTCTGGGGAGACGGG + Intergenic
907279854 1:53340219-53340241 GAAGAGTGCTCCGGGCAGACAGG + Intergenic
908416184 1:63915518-63915540 GAAGAGTGCAATGGAGAGAAGGG + Intronic
912965559 1:114233806-114233828 GAAGACTTTTCTGATGAGACTGG + Intergenic
915051879 1:153083981-153084003 AGAGAGTGCTCAGGTCAGACTGG - Intergenic
918610511 1:186484919-186484941 GAAGAATACTTAGGTGAGACAGG + Intergenic
920266312 1:204726053-204726075 GAAGAGGGCTGTGGAGGGACAGG + Intergenic
920567638 1:206988137-206988159 GCAGAGAGCTGTGCTGAGACTGG + Intergenic
920852117 1:209635023-209635045 GAAGAGCTCTCTGGTGAGTGGGG - Intronic
921031127 1:211336004-211336026 GTAGAGTTTCCTGGTGAGACTGG + Intronic
921098899 1:211911392-211911414 GAAGAGGGCTCTTGTGAGTTAGG + Intergenic
921895052 1:220391113-220391135 GAAGAGTGGACTGGGCAGACTGG + Intergenic
1070931600 10:80264868-80264890 GGAGAGTGCTCTGGGGCCACAGG - Intergenic
1071879151 10:89875674-89875696 AAAGAATGCACTGGTGAGAAGGG - Intergenic
1073394196 10:103204811-103204833 GAAAATGGCTCTGGTGAGATGGG + Intergenic
1074883001 10:117673002-117673024 GAAGGGAGCTCTGGCCAGACAGG + Intergenic
1076562807 10:131377960-131377982 GAACACTGCTGTGGCGAGACAGG - Intergenic
1077069287 11:660578-660600 GAAGAGTTCCCTGGGGACACGGG + Intronic
1078219639 11:9340957-9340979 GAAGAGTGTTGTTGGGAGACTGG - Intergenic
1079082232 11:17421844-17421866 GGAGAATGCTCTGGGGAGATGGG - Intronic
1079398285 11:20084849-20084871 GAATAGTGCTCTGCTCACACAGG - Intronic
1079419640 11:20273992-20274014 GAAGCATCCTCTGGTGAGGCTGG + Intergenic
1079785145 11:24663187-24663209 GAGGAGGGCTCTGGTGGGAGGGG + Intronic
1082193308 11:49273059-49273081 CAAGAGTGCTCAGCTGAGCCTGG - Intergenic
1083580910 11:63824809-63824831 GTAGGGTGCATTGGTGAGACTGG - Intronic
1086184665 11:83999091-83999113 GCAGAATGCTCAGGTGTGACTGG - Intronic
1086672834 11:89568123-89568145 CAAGAGTGCTCAGCTGAGCCTGG + Intergenic
1087160496 11:94943496-94943518 GCAGATTTCTCTGGTGAGAAGGG + Intergenic
1088806684 11:113359097-113359119 GAAGAGTCAGCTGCTGAGACGGG - Intronic
1089731264 11:120520559-120520581 GATTAGTGCTCAGGTGAGACAGG + Intronic
1090240055 11:125175392-125175414 GAACTGGGCTCTGGGGAGACAGG + Intronic
1090756047 11:129792878-129792900 GAAAAGTAATCTGGTGTGACAGG + Intergenic
1090973368 11:131661338-131661360 GAAAAGTGTTCTGGAGAGGCAGG + Intronic
1093222961 12:16446084-16446106 AAACGGTGCTCTGGTCAGACTGG - Intronic
1093510410 12:19920508-19920530 GAGGAGGGGTCTGGTGAGAGGGG + Intergenic
1099470048 12:83036965-83036987 AGTGAGTTCTCTGGTGAGACTGG - Intronic
1100036724 12:90260573-90260595 GAAGGGTGCTGTGGTTAGATGGG - Intergenic
1100809587 12:98325130-98325152 GAGGAGTGCTCAGGTGCCACTGG + Intergenic
1101397568 12:104362088-104362110 GATCAGTGCTGTGCTGAGACAGG + Intergenic
1101478338 12:105072982-105073004 AAAAAGTACTCTGCTGAGACAGG + Intronic
1104585477 12:130045002-130045024 GAAGAGTGGCCTGGTGACTCGGG + Intergenic
1104719177 12:131035149-131035171 GGAGAGTGCTCTGGGCAGAGGGG - Intronic
1105255823 13:18743616-18743638 GAAGAATGCTCTGGTGAGATAGG + Intergenic
1107194055 13:37626228-37626250 AAAAATTGCTCTGATGAGACTGG - Intergenic
1107671073 13:42746807-42746829 TAAGAGTGCTCTAGTGAGTAGGG - Intergenic
1109801781 13:67388964-67388986 GAAGGCTGATCTGGAGAGACCGG + Intergenic
1112938963 13:104837656-104837678 GAAGGGTGATGTGGTGAGAGAGG - Intergenic
1113964744 13:114146473-114146495 GAAGAGTGCCCTATGGAGACTGG - Intergenic
1114775603 14:25477471-25477493 GATAAGAGCTCTGGTGAGAAAGG - Intergenic
1116649069 14:47566359-47566381 GAAGCATGCTCAGGTCAGACTGG + Intronic
1117440458 14:55754351-55754373 GAAGAGGGCTCTGTGGTGACTGG + Intergenic
1119049229 14:71349905-71349927 AAGGAGTGCTCTTGTGACACTGG + Intronic
1119144220 14:72295366-72295388 GGAGAGTGCTCTGGTGCAGCTGG + Intronic
1121850849 14:97219838-97219860 GAAGAGTGCACTGGGGACCCAGG - Intergenic
1122188476 14:100020902-100020924 GCAGTGTGCTCTGGTGACATGGG + Intronic
1122285027 14:100645896-100645918 GCAGAGGGCGCTGGAGAGACAGG - Intergenic
1122402960 14:101478217-101478239 GAAGAGAGCTCTGGTGGCTCCGG - Intergenic
1122502823 14:102212601-102212623 GAAGAGGGCACTGGAGAGAGGGG + Intronic
1123127127 14:105954582-105954604 CAAGAGTGCTGAGGTGAGCCTGG + Intergenic
1123687682 15:22810958-22810980 GGAGAGTGCCCTGGGGAGGCAGG - Intronic
1127755966 15:62092341-62092363 GCAGAGTGGCCTGTTGAGACTGG + Intergenic
1128153348 15:65377164-65377186 GAGGAGTGCGCGGGAGAGACAGG - Intronic
1128565643 15:68699131-68699153 GGAGAGTCATCTGGTGTGACTGG + Intronic
1132327432 15:100983493-100983515 GAACAGGGCTCCAGTGAGACTGG - Intronic
1132425468 15:101712473-101712495 GAAGACTGCTCTGGAGATGCAGG - Intronic
1135800448 16:25489221-25489243 GAAGGGTGCCCAGGTAAGACTGG + Intergenic
1136990720 16:35149850-35149872 GAAGAATGCTCTGGTGAGGCAGG + Intergenic
1138867403 16:60839571-60839593 GCAGTGTGCTCTGCTGAGATGGG + Intergenic
1139548959 16:67663022-67663044 GAAGAGTGCTCTAGGGACACTGG + Exonic
1144733322 17:17541034-17541056 GCTGAGTGCTCGGCTGAGACGGG + Intronic
1146000077 17:29125715-29125737 GAGAAGTGCTCTGGGGAGAGTGG - Intronic
1147370493 17:39989310-39989332 GAAGAGTGTTCTGGACAGAGGGG - Intronic
1154435201 18:14337058-14337080 GAAGAATGCTCTGGTGAGATAGG - Intergenic
1157166712 18:45364068-45364090 GGAGGGGGCTCAGGTGAGACGGG - Intronic
1157337274 18:46750617-46750639 GAAGAGGGCTCGGGTGGGATAGG - Intronic
1159688366 18:71453015-71453037 GAAGAAGGCTCCGGTGAGAATGG + Intergenic
1159906092 18:74093506-74093528 TAAGGGTGCTCAGGTGAGTCTGG + Intronic
1160610859 18:80084003-80084025 GAAAAGTGCCCTAGAGAGACTGG + Intronic
1164588298 19:29491472-29491494 GATGTGTCCTGTGGTGAGACAGG + Intergenic
926399120 2:12477541-12477563 GAAGAGTTCTTTGGAGAGATGGG + Intergenic
926978473 2:18538895-18538917 GGATAGTGGTCTTGTGAGACTGG + Intergenic
929607523 2:43244872-43244894 GAGGAGTGCTCTGGGGTGAGTGG - Intronic
929994512 2:46817022-46817044 GAAGAGGACTCTGCTGAGTCTGG + Intronic
930147292 2:48020211-48020233 AAAGAGTCCTCTGGGGAAACAGG - Intergenic
930785524 2:55268366-55268388 GTAGAGTGCTCAGGTAACACAGG + Intronic
930906939 2:56581036-56581058 GAAGTGTGTGCTGGTGAGAGGGG + Intergenic
933636258 2:84711998-84712020 GTAGAGTGCTCTTGGGAGAGGGG + Intronic
934490822 2:94761175-94761197 GAAGAATGCTCTGGTGAGACAGG + Intergenic
937905481 2:127050903-127050925 GAAGAGAGCTCTGGTGGCAGAGG + Exonic
939014476 2:136886137-136886159 GATGGGAGCTCAGGTGAGACGGG + Intronic
941166970 2:162093050-162093072 GAAGTGTGCTGTGGTGTGGCAGG - Intergenic
941769401 2:169329136-169329158 GAAGACTTCTCTGATGACACCGG - Intronic
942490863 2:176488450-176488472 GATGAGCCCTCTGGTGAGAGTGG - Intergenic
946587642 2:221208159-221208181 GAAAAGTGCTTTGGAGAGAGAGG - Intergenic
947263632 2:228252265-228252287 AAAGTGTGCTCAGGTCAGACTGG + Intergenic
948270829 2:236671999-236672021 GGAGAGTGCTCTGGTGAGATGGG - Intergenic
948477278 2:238228103-238228125 GAAGAGAGAGCTGGTGAGATGGG + Intronic
1170096032 20:12646924-12646946 GAAGGCTGCTCTGGTGAAAATGG + Intergenic
1172821992 20:37744647-37744669 GAAGAGTGCTGTGGTGAGTGAGG + Intronic
1175174865 20:57105037-57105059 GAAGAGGACTCTGGTGACAATGG + Intergenic
1175375986 20:58524355-58524377 GAAGAGAGCTTGGGTGATACAGG + Intergenic
1177782065 21:25632314-25632336 TAAGAGTGCTCTGGAGAGCAGGG + Intergenic
1179826029 21:43967004-43967026 GAAGAGTTCCGTGGTGAGAACGG - Intronic
1181005256 22:20010384-20010406 GCAGAGTGTTCTGGTGGGCCTGG - Intronic
1183580802 22:38725543-38725565 GGAGAGTTCTCTGGTGTGGCTGG + Intronic
1184171850 22:42764691-42764713 GAGGAGAGCTCTGGAGAGAGAGG - Intergenic
1184959874 22:47921246-47921268 GAAGAGTGCCCAGGTGGGGCCGG - Intergenic
949367731 3:3301283-3301305 AAAGAGCTCTCTGGGGAGACTGG - Intergenic
950552379 3:13674612-13674634 GCAGAGTGCTGTGGGGAGGCAGG + Intergenic
952954072 3:38545769-38545791 GAAGAGTGTTCTGGCAAGGCTGG + Intergenic
953743911 3:45558496-45558518 GAACTGTGCACTGGTGAGACAGG - Intronic
955374780 3:58385913-58385935 GAAAAGTGCTCTGCTGATTCTGG - Intronic
956037211 3:65107054-65107076 GAAGAGTGTACTGGGGAGAAGGG + Intergenic
957159735 3:76595023-76595045 GATTAGTGCCCTGATGAGACTGG + Intronic
959613494 3:108321060-108321082 GAGAAATGTTCTGGTGAGACTGG - Intronic
960551232 3:118978187-118978209 GAGGAGTGCTCAGGTGCCACGGG - Intronic
960860363 3:122146671-122146693 GAAGATGGCTCTGGGGAAACTGG - Intergenic
960965127 3:123099421-123099443 GAAGTGTGCTCAGATGGGACAGG + Intronic
962142411 3:132804383-132804405 GAAGATTGCTGGGGTGAGAAGGG - Intergenic
962839791 3:139223033-139223055 GAAGAGTGCACAGGTGACAATGG - Intronic
963368671 3:144369536-144369558 GAAAAGTGCTCTGGTGGGGATGG - Intergenic
967247100 3:187499082-187499104 GCACAGTTCTCTGGTGAAACTGG + Intergenic
967304531 3:188047811-188047833 AAAGAGTGCTCTGGTGTGTCTGG + Intergenic
967442824 3:189528522-189528544 CAAGAGTTGTCTGGTGAGCCTGG + Intergenic
968284144 3:197498541-197498563 CACCAGTGCTCTGGGGAGACTGG - Intergenic
968844199 4:3030870-3030892 GAAGAGTGATGTGATGAGACTGG + Intronic
969694076 4:8725102-8725124 GAACAGTGCCCTGGGGATACCGG + Intergenic
970050090 4:11904706-11904728 GAAAACTGCTCTTGTGTGACAGG + Intergenic
970752788 4:19384855-19384877 GATGAGTGATCTGGTGAGTTAGG - Intergenic
970939635 4:21616283-21616305 GAAGGGTGCAATTGTGAGACAGG - Intronic
971279066 4:25226292-25226314 GAAGAGTGCTCCTGGCAGACGGG - Intronic
971348209 4:25831381-25831403 GAAGATTTCTCTGGTTGGACAGG - Intronic
971454318 4:26829896-26829918 CCAGTGTGCTCTGGTAAGACAGG + Intergenic
971724671 4:30295093-30295115 TAAGAGGGCTTTGGTGTGACTGG - Intergenic
973034653 4:45390874-45390896 GGAGAGTGCTCAGATCAGACTGG + Intergenic
977322277 4:95532583-95532605 GAAGAGTGCTCCTGTGAGATGGG + Intronic
978034279 4:103975048-103975070 GAAAGGTGCTCTGGTAGGACTGG - Intergenic
979473992 4:121133582-121133604 GTACAGTGCTCTTGTGAAACAGG + Intronic
979967952 4:127098618-127098640 GAAGAGTTATCAGGTGACACTGG - Intergenic
980434187 4:132747720-132747742 GCAGAGTCCTGTGGTGACACAGG + Intergenic
980445474 4:132900930-132900952 GAAATGTGCCCTGGTAAGACAGG - Intergenic
983570328 4:169200784-169200806 CCAGAGTAGTCTGGTGAGACAGG + Intronic
984607263 4:181799936-181799958 GTAGAGTGGTCTGTGGAGACAGG + Intergenic
986579658 5:9252090-9252112 CAATAGAACTCTGGTGAGACAGG - Intronic
989260343 5:39412563-39412585 GAAAAATGCTCTGGGGAGAAAGG + Intronic
994970432 5:106730545-106730567 GAGGGGTGCTCAGGTCAGACTGG - Intergenic
996223599 5:120962485-120962507 GGAAAGAGCTGTGGTGAGACTGG - Intergenic
997626814 5:135336689-135336711 GAAAAGGGCTCTGCTGAGAGTGG + Intronic
997944907 5:138191478-138191500 GAAAATGGCTCTGGTGAAACTGG - Exonic
1002682197 5:180975360-180975382 GAAAAGAACACTGGTGAGACTGG + Intergenic
1006608486 6:35277232-35277254 GAGCAGAGCTCTTGTGAGACAGG + Intronic
1007071049 6:39038320-39038342 GAATAGTGCCCTGATGAGAATGG - Intergenic
1008040825 6:46796427-46796449 AAAGAGTGCTGAGGTGAGATAGG - Intronic
1008673420 6:53795424-53795446 GCAGAGCGCTCAGGTGAGGCCGG - Intronic
1009355586 6:62740303-62740325 GAGGAGTGCTCAGATTAGACTGG - Intergenic
1013598548 6:111683211-111683233 GAAGAGGGCTCAGCAGAGACAGG + Intronic
1013942874 6:115686681-115686703 GAATAGTGGTCTTCTGAGACAGG - Intergenic
1014715424 6:124859534-124859556 GGAGACTGCTGTGGTGACACAGG + Intergenic
1015472669 6:133623410-133623432 GAAGAGTCCTTTGGTGAGTCAGG - Intergenic
1016896743 6:149061000-149061022 GAAGAGGGCTCTGGTCAGCGCGG + Intronic
1020780305 7:12509613-12509635 GAAGAGTGAGTTGGTGAGAGGGG - Intergenic
1021613760 7:22481982-22482004 GAATCCTGCTCTGGGGAGACTGG + Intronic
1024298441 7:47864828-47864850 GAGGAGTACTCTACTGAGACAGG - Intronic
1024414848 7:49095015-49095037 GAAGACTGCATTGGTGAGCCAGG + Intergenic
1025118159 7:56276208-56276230 GAAGAGCTCCCTTGTGAGACAGG + Intergenic
1025260753 7:57416032-57416054 GAAGAATGCTCTGGTGAGACAGG + Intergenic
1026202223 7:68224199-68224221 GAAGAGCTCCCTTGTGAGACAGG + Intergenic
1027773284 7:82433749-82433771 GAAAAAGGCTCTGGTGAGAAGGG - Intronic
1030521094 7:110599088-110599110 GAAGAATGGTTTGGTGAGAAAGG - Intergenic
1032668587 7:134063181-134063203 GAAGAATAATCTGGTTAGACTGG - Intronic
1032748718 7:134814469-134814491 GAAGAGTGTAGTGGTGAGACTGG + Intronic
1033040951 7:137917855-137917877 GCTGAGTGCTATGGTGTGACGGG + Intronic
1034129850 7:148705649-148705671 GAAGGAGGCTTTGGTGAGACTGG + Intronic
1037808197 8:22069949-22069971 GAAGCAGGCTCTGGTGAGCCAGG - Intronic
1038146873 8:24905335-24905357 GGATAGTGATCTGGTCAGACTGG - Intergenic
1039297202 8:36169455-36169477 AAAGAATGGTCTGGTGAAACAGG - Intergenic
1039328247 8:36508733-36508755 GGAGAGTGCTCTAGTGATACTGG - Intergenic
1039638696 8:39194715-39194737 GAGGGGTGCTCAGGTCAGACTGG + Intronic
1040105458 8:43539055-43539077 GAAGAGTGTGCTGATGGGACAGG - Intergenic
1040555350 8:48473193-48473215 GAGGAGAGCACAGGTGAGACGGG + Intergenic
1041786249 8:61637619-61637641 GAGGGGTGATCTGGTGAGAAGGG - Intronic
1042976791 8:74478555-74478577 GAGGGGTGCTCAGGTCAGACTGG + Intronic
1047507558 8:125491780-125491802 GAAGGGTGCCCTGGGGAGAAGGG + Intergenic
1049624892 8:143615481-143615503 AAAGAGGGCTCTGGGGTGACAGG + Intronic
1049674855 8:143884889-143884911 GCAGATGGCTCTGGTGAGGCAGG - Intergenic
1050262020 9:3850609-3850631 GTAGAGTGCTGTGTAGAGACTGG - Intronic
1051751444 9:20346211-20346233 GAAGAGTGGTCCGCTGAGGCTGG + Exonic
1052881299 9:33602336-33602358 GAAGAGTGCTCTGGTGAGACAGG - Intergenic
1053495019 9:38543506-38543528 GAAGAGTGCTCTGGTGAGACAGG + Intronic
1053543000 9:38993945-38993967 GAAGGATGCTCAGGTCAGACTGG + Intergenic
1053667176 9:40324519-40324541 GAAGAGTGCTCTGGTGAGACAGG - Intronic
1053807443 9:41817462-41817484 GAAGGATGCTCAGGTCAGACTGG + Intergenic
1053916758 9:42949624-42949646 GAAGAGTGCTCTGGTGAGACAGG - Intergenic
1054378320 9:64464547-64464569 GAAGAGTGCTCTGGTGAGACAGG - Intergenic
1054517434 9:66051764-66051786 GAAGAGTGCTCTGGTGAGACAGG + Intergenic
1054623149 9:67369965-67369987 GAAGGATGCTCAGGTCAGACTGG - Intergenic
1061731187 9:132615358-132615380 GAAGGGTGCTCTTGTGGGAGTGG - Intronic
1062700134 9:137895867-137895889 GAAGAGTGGTGTGGCGAGAGAGG + Intronic
1203782744 EBV:109863-109885 CAAGAGTTCTCTGGTGAAACTGG - Intergenic
1187275588 X:17814101-17814123 GAGGAGTGAAGTGGTGAGACAGG + Intronic
1187586507 X:20668388-20668410 GAGAAATGCTCTGGTGAGTCAGG - Intergenic
1188169683 X:26909765-26909787 AAAGAGTGCTCTTCTGAGAACGG - Intergenic
1188833716 X:34931862-34931884 GAGGGGTGCTCAGGTCAGACTGG - Intergenic
1190640608 X:52480754-52480776 GAAGAAGGCTTTGGTGAGACAGG - Intergenic
1190647064 X:52532111-52532133 GAAGAAGGCTTTGGTGAGACAGG + Intergenic
1194544979 X:95222180-95222202 GAAGAGTGTTTGGGTGAGAGGGG + Intergenic
1194668703 X:96704460-96704482 AAAGAGTACTCTGATGTGACTGG - Intronic
1195128444 X:101831737-101831759 GAAGAGTTCCCTGGGCAGACAGG + Intergenic
1196964844 X:121044220-121044242 GAAGAGTGCTCTGGTGTTAATGG + Intergenic
1197034097 X:121853922-121853944 GAGGAGTGCTCAGGTCTGACCGG - Intergenic
1197790382 X:130248610-130248632 AAAGAGTGCTCAGGTCAGATGGG - Intronic
1198089143 X:133310584-133310606 GTAGTCTGCTCTGGTGAGAGTGG - Intronic
1198138702 X:133781190-133781212 GAAGAGTTCTCTGGCAACACAGG + Intronic
1199863508 X:151822671-151822693 CATGAGTGCTCTGGTGAGGCTGG + Intergenic
1200345410 X:155442158-155442180 GAGGAGTGCTCAGGTGCTACTGG - Intergenic
1201569516 Y:15399270-15399292 GAAGAGTGGTTTCCTGAGACAGG + Intergenic
1201963384 Y:19706784-19706806 GGAAAGGGCTCTGGTAAGACAGG - Exonic