ID: 1053667176

View in Genome Browser
Species Human (GRCh38)
Location 9:40324519-40324541
Sequence GAAGAGTGCTCTGGTGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053667176_1053667181 9 Left 1053667176 9:40324519-40324541 CCTGTCTCACCAGAGCACTCTTC No data
Right 1053667181 9:40324551-40324573 AGGTCTCAGGTGCTCTACAAGGG No data
1053667176_1053667180 8 Left 1053667176 9:40324519-40324541 CCTGTCTCACCAGAGCACTCTTC No data
Right 1053667180 9:40324550-40324572 GAGGTCTCAGGTGCTCTACAAGG No data
1053667176_1053667183 28 Left 1053667176 9:40324519-40324541 CCTGTCTCACCAGAGCACTCTTC No data
Right 1053667183 9:40324570-40324592 AGGGAGTCCCATTTCAGGTGTGG No data
1053667176_1053667185 30 Left 1053667176 9:40324519-40324541 CCTGTCTCACCAGAGCACTCTTC No data
Right 1053667185 9:40324572-40324594 GGAGTCCCATTTCAGGTGTGGGG No data
1053667176_1053667184 29 Left 1053667176 9:40324519-40324541 CCTGTCTCACCAGAGCACTCTTC No data
Right 1053667184 9:40324571-40324593 GGGAGTCCCATTTCAGGTGTGGG No data
1053667176_1053667179 -4 Left 1053667176 9:40324519-40324541 CCTGTCTCACCAGAGCACTCTTC No data
Right 1053667179 9:40324538-40324560 CTTCTGTCTGTAGAGGTCTCAGG No data
1053667176_1053667182 23 Left 1053667176 9:40324519-40324541 CCTGTCTCACCAGAGCACTCTTC No data
Right 1053667182 9:40324565-40324587 CTACAAGGGAGTCCCATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053667176 Original CRISPR GAAGAGTGCTCTGGTGAGAC AGG (reversed) Intronic