ID: 1053667177

View in Genome Browser
Species Human (GRCh38)
Location 9:40324528-40324550
Sequence CTACAGACAGAAGAGTGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 6, 1: 0, 2: 1, 3: 24, 4: 163}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053667177_1053667188 26 Left 1053667177 9:40324528-40324550 CCAGAGCACTCTTCTGTCTGTAG 0: 6
1: 0
2: 1
3: 24
4: 163
Right 1053667188 9:40324577-40324599 CCCATTTCAGGTGTGGGGCTGGG No data
1053667177_1053667184 20 Left 1053667177 9:40324528-40324550 CCAGAGCACTCTTCTGTCTGTAG 0: 6
1: 0
2: 1
3: 24
4: 163
Right 1053667184 9:40324571-40324593 GGGAGTCCCATTTCAGGTGTGGG No data
1053667177_1053667186 25 Left 1053667177 9:40324528-40324550 CCAGAGCACTCTTCTGTCTGTAG 0: 6
1: 0
2: 1
3: 24
4: 163
Right 1053667186 9:40324576-40324598 TCCCATTTCAGGTGTGGGGCTGG No data
1053667177_1053667182 14 Left 1053667177 9:40324528-40324550 CCAGAGCACTCTTCTGTCTGTAG 0: 6
1: 0
2: 1
3: 24
4: 163
Right 1053667182 9:40324565-40324587 CTACAAGGGAGTCCCATTTCAGG No data
1053667177_1053667185 21 Left 1053667177 9:40324528-40324550 CCAGAGCACTCTTCTGTCTGTAG 0: 6
1: 0
2: 1
3: 24
4: 163
Right 1053667185 9:40324572-40324594 GGAGTCCCATTTCAGGTGTGGGG No data
1053667177_1053667183 19 Left 1053667177 9:40324528-40324550 CCAGAGCACTCTTCTGTCTGTAG 0: 6
1: 0
2: 1
3: 24
4: 163
Right 1053667183 9:40324570-40324592 AGGGAGTCCCATTTCAGGTGTGG No data
1053667177_1053667180 -1 Left 1053667177 9:40324528-40324550 CCAGAGCACTCTTCTGTCTGTAG 0: 6
1: 0
2: 1
3: 24
4: 163
Right 1053667180 9:40324550-40324572 GAGGTCTCAGGTGCTCTACAAGG No data
1053667177_1053667181 0 Left 1053667177 9:40324528-40324550 CCAGAGCACTCTTCTGTCTGTAG 0: 6
1: 0
2: 1
3: 24
4: 163
Right 1053667181 9:40324551-40324573 AGGTCTCAGGTGCTCTACAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053667177 Original CRISPR CTACAGACAGAAGAGTGCTC TGG (reversed) Intronic
900333316 1:2147863-2147885 CTACAGACAGATGGGTGGACAGG - Intronic
900550565 1:3252423-3252445 CTAGAGCCAGAAGAAGGCTCTGG + Intronic
905450219 1:38051380-38051402 CAACTCACAGAAGAGAGCTCGGG - Intergenic
908346395 1:63237886-63237908 CTACAGACTGAAGGCTGCACTGG + Intergenic
908387138 1:63653563-63653585 ATAAAGACTGAAGAGTCCTCAGG + Intronic
908803779 1:67908654-67908676 CTATAGGCAGAAGGGTGCTCTGG + Intergenic
909279065 1:73725774-73725796 TTACAGACAGAAGCCTGCTTTGG - Intergenic
910145431 1:84075289-84075311 CTCTAGACAGAAGAGTGCCAAGG + Intergenic
912020285 1:105100302-105100324 CTACTGACAGAACAGGGCACAGG - Intergenic
912089840 1:106057555-106057577 GTATAGACAGAACAGTGCTTAGG + Intergenic
912228367 1:107762491-107762513 CTACAGATTGTAGAGAGCTCTGG + Intronic
914225664 1:145717847-145717869 CTAAAAACAGTAGGGTGCTCTGG - Intergenic
915715090 1:157937899-157937921 CTCCAGACAGAGAAGTGGTCAGG + Intergenic
915806426 1:158858435-158858457 TTACAGAGAACAGAGTGCTCTGG - Intergenic
915982440 1:160428962-160428984 ATACAGACACAAGCTTGCTCAGG - Intergenic
916927992 1:169543126-169543148 AGACAGACAGAAGAGAGATCTGG + Intronic
918005995 1:180542758-180542780 CTAGAGACAGCAGAGGGCCCTGG + Intergenic
918177687 1:182059991-182060013 CTTCAGACTGAAGCCTGCTCTGG + Intronic
920658019 1:207890794-207890816 CTACAGAGAAATGAGTTCTCAGG + Intronic
921358594 1:214309088-214309110 CTGCAGACAGAAGAGGGCTTGGG - Intronic
921879620 1:220240013-220240035 CTACAGACACAAGAATGATGTGG - Intronic
921968059 1:221114448-221114470 CTAAAGAAAGAAGAGTGCCCAGG - Intergenic
921989563 1:221349886-221349908 CTACAAACAGAAGAGGACTCAGG - Intergenic
1063621765 10:7655924-7655946 TTACAGATAGAAGAATGCTCAGG - Intronic
1065713228 10:28537083-28537105 ATACAGTCAGAAGATTGCACTGG + Intronic
1066256497 10:33684426-33684448 CTCCAGACAGGAGCTTGCTCAGG + Intergenic
1067879299 10:50029783-50029805 CTGCAGACAGAGGAGGACTCAGG - Intergenic
1068115919 10:52737386-52737408 CTCTAGACAGAGCAGTGCTCTGG + Intergenic
1068631307 10:59300918-59300940 ATACATACAGAAAAGTGCACAGG - Intronic
1069364075 10:67677802-67677824 ACACAGACAGAAGGGTGCTCTGG + Intronic
1072589140 10:96811443-96811465 CCACAGAGAAAAGAGTGCCCAGG + Intergenic
1074059819 10:109954779-109954801 TTACAGACAGAAAAGAGCTGAGG + Intergenic
1074497343 10:113991643-113991665 CTACAGATACAAGAGTGGACAGG - Intergenic
1075732101 10:124642510-124642532 CAACAGGCAGATGGGTGCTCAGG + Intronic
1080915554 11:36654873-36654895 CTGGAGCCAGAAGAGTACTCAGG - Intronic
1081706702 11:45186360-45186382 CCACACACACCAGAGTGCTCTGG - Intronic
1082755582 11:57072769-57072791 CTTCAGAAAGAAGTATGCTCTGG + Intergenic
1084944233 11:72630339-72630361 CGACAGACAGCAGAGCGCCCTGG + Intronic
1086965427 11:93022351-93022373 TTATAGACAGAAGAAGGCTCAGG + Intergenic
1089018613 11:115187916-115187938 CTACAGACAAGAAAGTGATCTGG - Intronic
1089589921 11:119533591-119533613 CTCCAGACAGAAGGGTGCAGGGG - Intergenic
1089687802 11:120168264-120168286 CTACAGACAGAAGCAAGCTTCGG + Intronic
1091637950 12:2212249-2212271 CCACAGGCTGATGAGTGCTCAGG - Intronic
1091694296 12:2617571-2617593 CTGCAGAGAAAAGACTGCTCTGG - Intronic
1093889250 12:24499578-24499600 CAACAGAAGGAAGAATGCTCTGG + Intergenic
1094042855 12:26135452-26135474 GTACAGACAAAAGAGAGCTGGGG + Intronic
1095549394 12:43416148-43416170 CTACAGACACTTGAGTGCTCTGG + Intronic
1097022772 12:56032613-56032635 CTACAAACAGCAGAGTACCCTGG + Exonic
1098617809 12:72552161-72552183 TTACATACAGAACAGTTCTCTGG + Intronic
1099394465 12:82121007-82121029 CAGCAGACTGAAGCGTGCTCAGG - Intergenic
1104418962 12:128619491-128619513 CTCCAAACAAAAGAGTGCCCAGG - Intronic
1104574311 12:129952877-129952899 CTACACGCTGAAGAGTGCTAAGG + Intergenic
1105255822 13:18743607-18743629 CTACAGATGGAAGAATGCTCTGG + Intergenic
1107044137 13:35977296-35977318 ATGCAGACAGCAGATTGCTCAGG - Intronic
1107178655 13:37430013-37430035 CTAAAAACAGATGAGTCCTCAGG + Intergenic
1107616764 13:42177062-42177084 ATACATACAGAAGAGTGCACAGG + Intronic
1108515628 13:51200047-51200069 CTCCAGACACAACAGTGCACTGG - Intergenic
1109607559 13:64716759-64716781 CTACAGACACATGAATGCTAAGG + Intergenic
1110642211 13:77838573-77838595 CTACAGACAACAGAGTTCTTTGG - Intergenic
1114636423 14:24189524-24189546 GTACAGACAGTAGAGTTCTTCGG - Exonic
1115612854 14:35065548-35065570 ATATAGACAGAATGGTGCTCAGG + Intronic
1116624755 14:47250213-47250235 CTAAAGGCAGAACAGTTCTCTGG + Intronic
1116649068 14:47566350-47566372 CAGCAGACAGAAGCATGCTCAGG + Intronic
1116866814 14:50038064-50038086 CTCCAGCCAGAAGTATGCTCGGG + Intergenic
1121752331 14:96367892-96367914 CTAGAAACAGAATATTGCTCAGG + Intronic
1124008884 15:25818880-25818902 CTACATGCAGAAGAATGATCTGG + Intronic
1126225134 15:46261648-46261670 CAGCAGACCAAAGAGTGCTCGGG + Intergenic
1127975125 15:63991352-63991374 CTGCAAACAGAAGAGGGCACAGG + Intronic
1129222787 15:74142536-74142558 CAAAAGACAGAAGAGTCCTTTGG + Intergenic
1136990718 16:35149841-35149863 CTGTGGACAGAAGAATGCTCTGG + Intergenic
1137805578 16:51302262-51302284 CTACAGACAGAATAGAGATCTGG - Intergenic
1139480916 16:67230212-67230234 CTCCAGACAGAGAAGTTCTCAGG - Exonic
1140556806 16:75930684-75930706 CTCCAGAGGGAAGAGTGCTGTGG + Intergenic
1142606921 17:1087250-1087272 CTGCAGAAAGCAGAGTGGTCCGG - Intronic
1142642464 17:1292351-1292373 CTGCAGACAGAAGGGTGTTTTGG + Intronic
1143237892 17:5419114-5419136 CTAGTGACGGATGAGTGCTCTGG - Intronic
1145069174 17:19788522-19788544 CTGCTGACTGAAGAGTCCTCGGG + Intronic
1145880347 17:28348335-28348357 CTAGAGATAGAAGAGAGCTCAGG - Intronic
1147606216 17:41775236-41775258 CAACAGACAGAAGAAGGCTGGGG + Intronic
1148108900 17:45133387-45133409 CTACAGAGAGGCTAGTGCTCAGG + Intronic
1149127553 17:53254349-53254371 CAGCAAACAGAAGAGTGCTCAGG - Intergenic
1150045353 17:61907437-61907459 GTACAGACGTAAGAGTGCACTGG + Exonic
1153592221 18:6685588-6685610 CAGCATACAGAAGAGGGCTCAGG - Intergenic
1154435202 18:14337067-14337089 CTACAGATGGAAGAATGCTCTGG - Intergenic
1155592570 18:27444763-27444785 CTATAGAAAGAAGAGTGATCTGG - Intergenic
1159395105 18:67846438-67846460 CACCAGACAGAAGGGTTCTCAGG - Intergenic
1159505267 18:69328010-69328032 CAGCAGACCGAGGAGTGCTCAGG - Intergenic
1159906091 18:74093497-74093519 CAGCAGACATAAGGGTGCTCAGG + Intronic
1160403892 18:78631294-78631316 CAAAAGACAGAAGAGTGGCCTGG - Intergenic
1161852136 19:6743171-6743193 CTACAGAAAGAAGAGTGATAAGG - Intronic
1164551966 19:29219464-29219486 CCCCAGAGAGAAGAGGGCTCTGG - Intergenic
1166030300 19:40120337-40120359 TTACAGACAGAAAAGGGCTGAGG + Intergenic
1166223834 19:41382749-41382771 CTACGGACAGGAAAGTGCCCAGG - Intronic
926667959 2:15545495-15545517 CTACAGACAGAAGGGTAATAGGG + Intronic
926756737 2:16242539-16242561 ATAGAGACAGAAGAGTACCCTGG + Intergenic
929084043 2:38149905-38149927 TTACAGACAGAAAAGGGCTGTGG - Intergenic
931601105 2:64003990-64004012 TTTCTGACACAAGAGTGCTCAGG - Intronic
933605230 2:84375622-84375644 CTAAAGACAGGAAGGTGCTCTGG - Intergenic
933701637 2:85259198-85259220 CTGCAGACTGATGAGTGTTCTGG + Intronic
934490821 2:94761166-94761188 CTACAGATGGAAGAATGCTCTGG + Intergenic
938051717 2:128179042-128179064 CTACAGCCAGAAGAGGCCACGGG + Intronic
941864259 2:170317590-170317612 CTGCAAACAGAAGAGGACTCTGG - Intronic
946064543 2:216975311-216975333 CTTCAGACAGAGGATGGCTCTGG - Intergenic
946981330 2:225219177-225219199 CTGCAGACAAGAGAGTGTTCAGG + Intergenic
948832697 2:240605974-240605996 CTACAGAGAGCCGAGAGCTCCGG - Intronic
1170399322 20:15962810-15962832 CCACAGACAGGACATTGCTCAGG - Intronic
1173639676 20:44592037-44592059 CCACAGACAAAAGAGTGCTTGGG + Intronic
1173661102 20:44734332-44734354 CCATAGACAGAAGAGCCCTCAGG - Intergenic
1174379644 20:50148404-50148426 CTACAGCCAGAAGACAGCCCGGG - Intronic
1176841836 21:13848634-13848656 CTACAGATGGAAGAATGCTCTGG + Intergenic
1177944753 21:27454098-27454120 CTAAAGGCAGAAGAGTGTTCAGG + Intergenic
1178757664 21:35367777-35367799 TGACAAACAGAAGAGTCCTCTGG + Intronic
1184016971 22:41793601-41793623 CTACATTCAGGAGAGTGCTTTGG - Intronic
1184400625 22:44271762-44271784 CTACAGAGAGAAGTGTGGTTGGG - Intronic
950923135 3:16715513-16715535 CAACAGACCAAGGAGTGCTCAGG + Intergenic
951159479 3:19399984-19400006 CTACAGACAGAAACATGTTCAGG - Intronic
952709087 3:36411226-36411248 CTATAGACAGAAGATGGCTTAGG - Intronic
953863350 3:46563856-46563878 CTGCAGACAGAGGTGTGCTATGG + Intronic
954005091 3:47584244-47584266 ATATAGACAAAAGGGTGCTCTGG + Intergenic
954457035 3:50605302-50605324 CTACAGACAGCCAAGCGCTCAGG + Intergenic
958464615 3:94442691-94442713 CAGCAGACCAAAGAGTGCTCAGG - Intergenic
959881414 3:111448386-111448408 CAGCAGACAGGAGAATGCTCAGG - Intronic
961601912 3:128068751-128068773 GTGCAGACTGAAGAGTGCTGTGG - Intronic
964961134 3:162427951-162427973 CTACTGACTGCAGAGTGCTAGGG + Intergenic
965945291 3:174233075-174233097 TTACAGACAGAAGGGTGCTCTGG + Intronic
971969913 4:33607039-33607061 CAACAGACCAAGGAGTGCTCAGG - Intergenic
972292162 4:37699201-37699223 CTCCAGACAGGAGAGTACCCTGG + Intergenic
977553525 4:98466653-98466675 CCATAGACAGAGGAGTTCTCAGG + Intergenic
978061551 4:104345543-104345565 CTACAGAAGGAAGAGAGCTCTGG - Intergenic
978653972 4:111044601-111044623 CCATAGAAAGAAGAGTCCTCAGG + Intergenic
983756771 4:171348294-171348316 CTGCAGACAGAAGTGGACTCTGG - Intergenic
985945473 5:3179087-3179109 GTCCCGACAGAAGAGTCCTCCGG - Intergenic
986477677 5:8152343-8152365 CTACAGAAAGGAAACTGCTCAGG - Intergenic
987160058 5:15132730-15132752 CAACAGACAGGAGAGAACTCAGG + Intergenic
989622808 5:43401369-43401391 ATACAGACACTAGAGTGGTCAGG + Intronic
994815299 5:104578514-104578536 TTAAAAACAGAGGAGTGCTCAGG + Intergenic
996082825 5:119274140-119274162 ACACAGTCAGAAGAGAGCTCAGG - Intronic
997350158 5:133225285-133225307 CTGCAGACAGGACAGTGCTCAGG + Intronic
997986077 5:138502571-138502593 CTAAAGACAGAAGAAAGCTGAGG - Intergenic
1001208011 5:169782045-169782067 GAACAGACAGCAGAGTGCTGTGG - Intronic
1001376218 5:171261123-171261145 CTAAAGAGAGAAGAATGCTTTGG + Intronic
1005603501 6:27451497-27451519 GTTCAGTCAGATGAGTGCTCCGG + Exonic
1007868476 6:45003742-45003764 CAAAAGACAAAAGATTGCTCAGG - Exonic
1010109685 6:72211311-72211333 CTACAGAATGAAGACTGCCCAGG - Intronic
1010619701 6:78059804-78059826 TTACAGACAGAAGCCTGGTCTGG - Intergenic
1010819676 6:80398601-80398623 CTACAAACAAAAGACAGCTCAGG + Intergenic
1012632204 6:101484931-101484953 TGACAGACAGCAGACTGCTCCGG + Intronic
1014183372 6:118408533-118408555 CAACAGACCGAGGAGTGCTCAGG - Intergenic
1014425712 6:121302825-121302847 CTAGAGACAGAATTGTGTTCTGG + Intronic
1014884687 6:126765221-126765243 ATACAGACAGAAGAGAACTTGGG - Intergenic
1019051623 6:169188114-169188136 CTCCACACAGAGGAGAGCTCTGG + Intergenic
1019508436 7:1405128-1405150 CTACAGACAGAAGAAGGGTGAGG + Intergenic
1021029799 7:15717545-15717567 CTACAGACACAAAAGTACACAGG - Intergenic
1021907361 7:25348582-25348604 ATACAAACAAAAGAGTTCTCTGG + Intergenic
1023070317 7:36425028-36425050 ACACAGAGAGAAGAGGGCTCAGG - Intronic
1024358631 7:48444609-48444631 ATAAAGAGAGAAGAGAGCTCAGG - Intronic
1024944629 7:54796501-54796523 CTACAGACAGAATAGTGACCAGG - Intergenic
1025260752 7:57416023-57416045 CTGTGGACAGAAGAATGCTCTGG + Intergenic
1025779818 7:64591291-64591313 CTACATACAGCCCAGTGCTCAGG + Intergenic
1030939684 7:115630645-115630667 CAACAGACAGATGAGTGGACAGG - Intergenic
1033728086 7:144142872-144142894 CTACAGTCTGAGGAATGCTCAGG + Intergenic
1034351421 7:150417353-150417375 CTGCAGAAAGCAGAGTGCTGAGG - Intergenic
1039386456 8:37140273-37140295 CTGCAGATAGAAGAGAGCTTGGG - Intergenic
1041980631 8:63855145-63855167 CTGGAGACAGAAGAATGCTCTGG + Intergenic
1046832586 8:118762642-118762664 CTAAAGACAGAGGATTGTTCTGG + Intergenic
1047794605 8:128241714-128241736 CTTCATAGAGAAGAGTGCTTTGG - Intergenic
1047801904 8:128318840-128318862 CTGCAGACAGAGGAGGCCTCTGG - Intergenic
1048886387 8:138913442-138913464 CTAAAGAGCGAAGTGTGCTCAGG + Intronic
1050277960 9:4019621-4019643 CTACACACAGATAAGTGCTATGG + Intronic
1052389873 9:27867031-27867053 CTGCGGACAAAAGAGCGCTCAGG - Intergenic
1052881300 9:33602345-33602367 CTACAGACAGAAGAGTGCTCTGG - Intergenic
1053495018 9:38543497-38543519 CTACAGACAGAAGAGTGCTCTGG + Intronic
1053667177 9:40324528-40324550 CTACAGACAGAAGAGTGCTCTGG - Intronic
1053916759 9:42949633-42949655 CTACAGACAGAAGAGTGCTCTGG - Intergenic
1054378321 9:64464556-64464578 CTACAGACAGAAGAGTGCTCTGG - Intergenic
1054517433 9:66051755-66051777 CTACAGACAGAAGAGTGCTCTGG + Intergenic
1055657202 9:78462811-78462833 CGCCAGACAGAAGAATGCTGAGG + Intergenic
1062038472 9:134393200-134393222 CTACAGGGAGAAGAGCGCCCAGG - Intronic
1187402606 X:18974967-18974989 GTACAGACAGAAGAGAGATGAGG - Intronic
1187728014 X:22223877-22223899 CTGGAGACAGAAGACTGCTTGGG + Intronic
1188026292 X:25213444-25213466 CTATTGATAGAAGAGTGCACAGG + Intergenic
1192465273 X:71350667-71350689 CTACAGAAAGTAGAGTACTTCGG + Intergenic
1192473016 X:71415815-71415837 CTACAGAAAGTAGAGTACTTCGG - Intronic
1192684446 X:73288954-73288976 CAACAGACAAAGGGGTGCTCAGG - Intergenic
1193882157 X:86936509-86936531 CAACAGACAGAGGAATGCTGAGG + Intergenic
1194138730 X:90180909-90180931 CTACAGACAGAACAGCTCTGAGG - Intergenic
1194917599 X:99723873-99723895 CAGCAGACCAAAGAGTGCTCAGG - Intergenic
1197093738 X:122570630-122570652 TAGCAGACAGAAGGGTGCTCAGG - Intergenic
1197455183 X:126670431-126670453 CTAGAGACAGGAGAGAGCTGGGG + Intergenic
1197957943 X:131973258-131973280 CTGCAAATAGAAGAGAGCTCGGG + Intergenic
1198154845 X:133948784-133948806 GTACAGACAAAAGAGTACTTAGG - Intronic
1199375851 X:147109046-147109068 CAACAGACCAACGAGTGCTCAGG - Intergenic
1199786698 X:151112444-151112466 CAGCAAACAGAAGGGTGCTCAGG + Intergenic
1200484531 Y:3751143-3751165 CTACAGACAGAACAGCTCTGAGG - Intergenic