ID: 1053667177

View in Genome Browser
Species Human (GRCh38)
Location 9:40324528-40324550
Sequence CTACAGACAGAAGAGTGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053667177_1053667180 -1 Left 1053667177 9:40324528-40324550 CCAGAGCACTCTTCTGTCTGTAG No data
Right 1053667180 9:40324550-40324572 GAGGTCTCAGGTGCTCTACAAGG No data
1053667177_1053667185 21 Left 1053667177 9:40324528-40324550 CCAGAGCACTCTTCTGTCTGTAG No data
Right 1053667185 9:40324572-40324594 GGAGTCCCATTTCAGGTGTGGGG No data
1053667177_1053667188 26 Left 1053667177 9:40324528-40324550 CCAGAGCACTCTTCTGTCTGTAG No data
Right 1053667188 9:40324577-40324599 CCCATTTCAGGTGTGGGGCTGGG No data
1053667177_1053667186 25 Left 1053667177 9:40324528-40324550 CCAGAGCACTCTTCTGTCTGTAG No data
Right 1053667186 9:40324576-40324598 TCCCATTTCAGGTGTGGGGCTGG No data
1053667177_1053667184 20 Left 1053667177 9:40324528-40324550 CCAGAGCACTCTTCTGTCTGTAG No data
Right 1053667184 9:40324571-40324593 GGGAGTCCCATTTCAGGTGTGGG No data
1053667177_1053667181 0 Left 1053667177 9:40324528-40324550 CCAGAGCACTCTTCTGTCTGTAG No data
Right 1053667181 9:40324551-40324573 AGGTCTCAGGTGCTCTACAAGGG No data
1053667177_1053667183 19 Left 1053667177 9:40324528-40324550 CCAGAGCACTCTTCTGTCTGTAG No data
Right 1053667183 9:40324570-40324592 AGGGAGTCCCATTTCAGGTGTGG No data
1053667177_1053667182 14 Left 1053667177 9:40324528-40324550 CCAGAGCACTCTTCTGTCTGTAG No data
Right 1053667182 9:40324565-40324587 CTACAAGGGAGTCCCATTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053667177 Original CRISPR CTACAGACAGAAGAGTGCTC TGG (reversed) Intronic