ID: 1053667183

View in Genome Browser
Species Human (GRCh38)
Location 9:40324570-40324592
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053667177_1053667183 19 Left 1053667177 9:40324528-40324550 CCAGAGCACTCTTCTGTCTGTAG No data
Right 1053667183 9:40324570-40324592 AGGGAGTCCCATTTCAGGTGTGG No data
1053667176_1053667183 28 Left 1053667176 9:40324519-40324541 CCTGTCTCACCAGAGCACTCTTC No data
Right 1053667183 9:40324570-40324592 AGGGAGTCCCATTTCAGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type