ID: 1053668538

View in Genome Browser
Species Human (GRCh38)
Location 9:40336389-40336411
Sequence ACAGCTTGTGGGCTGAATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053668538_1053668543 -6 Left 1053668538 9:40336389-40336411 CCTGCATTCAGCCCACAAGCTGT No data
Right 1053668543 9:40336406-40336428 AGCTGTGGGTTAGACAAGCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053668538 Original CRISPR ACAGCTTGTGGGCTGAATGC AGG (reversed) Intergenic
No off target data available for this crispr