ID: 1053672999

View in Genome Browser
Species Human (GRCh38)
Location 9:40388733-40388755
Sequence TTGGAGACTCAGAGCGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053672999_1053673007 16 Left 1053672999 9:40388733-40388755 CCCTCCCCGCTCTGAGTCTCCAA No data
Right 1053673007 9:40388772-40388794 TGTATGACTTTGTGTAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053672999 Original CRISPR TTGGAGACTCAGAGCGGGGA GGG (reversed) Intergenic
No off target data available for this crispr