ID: 1053673007

View in Genome Browser
Species Human (GRCh38)
Location 9:40388772-40388794
Sequence TGTATGACTTTGTGTAACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053672999_1053673007 16 Left 1053672999 9:40388733-40388755 CCCTCCCCGCTCTGAGTCTCCAA No data
Right 1053673007 9:40388772-40388794 TGTATGACTTTGTGTAACCAAGG No data
1053673000_1053673007 15 Left 1053673000 9:40388734-40388756 CCTCCCCGCTCTGAGTCTCCAAT No data
Right 1053673007 9:40388772-40388794 TGTATGACTTTGTGTAACCAAGG No data
1053673004_1053673007 -3 Left 1053673004 9:40388752-40388774 CCAATGACCATTTTACCATCTGT No data
Right 1053673007 9:40388772-40388794 TGTATGACTTTGTGTAACCAAGG No data
1053673002_1053673007 11 Left 1053673002 9:40388738-40388760 CCCGCTCTGAGTCTCCAATGACC No data
Right 1053673007 9:40388772-40388794 TGTATGACTTTGTGTAACCAAGG No data
1053672998_1053673007 25 Left 1053672998 9:40388724-40388746 CCTCTGTCACCCTCCCCGCTCTG No data
Right 1053673007 9:40388772-40388794 TGTATGACTTTGTGTAACCAAGG No data
1053673003_1053673007 10 Left 1053673003 9:40388739-40388761 CCGCTCTGAGTCTCCAATGACCA No data
Right 1053673007 9:40388772-40388794 TGTATGACTTTGTGTAACCAAGG No data
1053673001_1053673007 12 Left 1053673001 9:40388737-40388759 CCCCGCTCTGAGTCTCCAATGAC No data
Right 1053673007 9:40388772-40388794 TGTATGACTTTGTGTAACCAAGG No data
1053673005_1053673007 -10 Left 1053673005 9:40388759-40388781 CCATTTTACCATCTGTATGACTT No data
Right 1053673007 9:40388772-40388794 TGTATGACTTTGTGTAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053673007 Original CRISPR TGTATGACTTTGTGTAACCA AGG Intergenic
No off target data available for this crispr