ID: 1053678780

View in Genome Browser
Species Human (GRCh38)
Location 9:40465192-40465214
Sequence ACACTCCTGTATAAGGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053678780_1053678784 8 Left 1053678780 9:40465192-40465214 CCAGGCACCTTATACAGGAGTGT No data
Right 1053678784 9:40465223-40465245 GCATCACATCAGTGCCCCTCTGG No data
1053678780_1053678786 13 Left 1053678780 9:40465192-40465214 CCAGGCACCTTATACAGGAGTGT No data
Right 1053678786 9:40465228-40465250 ACATCAGTGCCCCTCTGGGATGG No data
1053678780_1053678790 29 Left 1053678780 9:40465192-40465214 CCAGGCACCTTATACAGGAGTGT No data
Right 1053678790 9:40465244-40465266 GGGATGGAGCTCAAAAAAGAAGG No data
1053678780_1053678785 9 Left 1053678780 9:40465192-40465214 CCAGGCACCTTATACAGGAGTGT No data
Right 1053678785 9:40465224-40465246 CATCACATCAGTGCCCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053678780 Original CRISPR ACACTCCTGTATAAGGTGCC TGG (reversed) Intergenic
No off target data available for this crispr