ID: 1053678781

View in Genome Browser
Species Human (GRCh38)
Location 9:40465199-40465221
Sequence AGCAGGAACACTCCTGTATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 867
Summary {0: 11, 1: 12, 2: 69, 3: 164, 4: 611}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053678781_1053678786 6 Left 1053678781 9:40465199-40465221 CCTTATACAGGAGTGTTCCTGCT 0: 11
1: 12
2: 69
3: 164
4: 611
Right 1053678786 9:40465228-40465250 ACATCAGTGCCCCTCTGGGATGG No data
1053678781_1053678785 2 Left 1053678781 9:40465199-40465221 CCTTATACAGGAGTGTTCCTGCT 0: 11
1: 12
2: 69
3: 164
4: 611
Right 1053678785 9:40465224-40465246 CATCACATCAGTGCCCCTCTGGG No data
1053678781_1053678784 1 Left 1053678781 9:40465199-40465221 CCTTATACAGGAGTGTTCCTGCT 0: 11
1: 12
2: 69
3: 164
4: 611
Right 1053678784 9:40465223-40465245 GCATCACATCAGTGCCCCTCTGG No data
1053678781_1053678791 28 Left 1053678781 9:40465199-40465221 CCTTATACAGGAGTGTTCCTGCT 0: 11
1: 12
2: 69
3: 164
4: 611
Right 1053678791 9:40465250-40465272 GAGCTCAAAAAAGAAGGAGCAGG No data
1053678781_1053678790 22 Left 1053678781 9:40465199-40465221 CCTTATACAGGAGTGTTCCTGCT 0: 11
1: 12
2: 69
3: 164
4: 611
Right 1053678790 9:40465244-40465266 GGGATGGAGCTCAAAAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053678781 Original CRISPR AGCAGGAACACTCCTGTATA AGG (reversed) Intergenic
900084651 1:886123-886145 AGCTGGAACGCTCCTGTAGGAGG + Intergenic
903783269 1:25836872-25836894 GGCAGGAACCCTGCTGTTTAAGG + Intronic
906366465 1:45214308-45214330 AGCAGGAACAATGCTATATCAGG + Intronic
906557938 1:46729077-46729099 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
906843003 1:49160452-49160474 AGCTGGAGCTCTCCTGTATGAGG + Intronic
906954375 1:50359795-50359817 AGTAGGAACATTCCTGTATAGGG - Intergenic
908584544 1:65554111-65554133 AGCTGGAGCTCTCCTGTATGAGG + Intronic
908598196 1:65710950-65710972 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
908910838 1:69071380-69071402 ACTAGGAACGCTCCTGTATAGGG + Intergenic
908930461 1:69311917-69311939 AGTAGGATCACTCCTGTATAGGG + Intergenic
909303162 1:74038539-74038561 AGTAGGAATGCTCATGTATAGGG - Intronic
909493049 1:76247206-76247228 AGCCGGATCTCTCCTGTATGAGG + Intronic
909697608 1:78484579-78484601 AGCAGGATCGCTCCTGTATAGGG - Intronic
910263458 1:85313816-85313838 AGAAGGACCACTCCTGCACATGG + Intergenic
910518259 1:88088134-88088156 AGTAGGATCGGTCCTGTATAGGG + Intergenic
910619278 1:89235675-89235697 AGTAGGAACGTTCTTGTATAAGG + Intergenic
910912601 1:92253504-92253526 AGCCGGAGCTCTCCTGTATGAGG - Intronic
912057250 1:105618916-105618938 ACCATAAACACTCCTGTATTAGG + Intergenic
912212636 1:107571507-107571529 AGCAGAAACACTCCTGTGGATGG - Exonic
912270951 1:108208849-108208871 AGCAGGAACTCTTCTCTATGAGG + Intergenic
912276407 1:108262627-108262649 AGCCGGAACTCTCCTGCATGAGG - Intergenic
912291821 1:108431731-108431753 AGCCGGAACTCTCCTGCATGAGG + Intronic
913021361 1:114791729-114791751 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
913390882 1:118311095-118311117 TGGAGGAACATTCCTGTATTTGG + Intergenic
913430032 1:118780699-118780721 AGCTGGAGCTCTCCTGTAAAAGG + Intergenic
915649173 1:157294964-157294986 AGCTGGAGCTCTCCTGTATGTGG - Intergenic
915992183 1:160529353-160529375 AGCTCGAGCTCTCCTGTATAAGG + Intergenic
916406358 1:164501214-164501236 AGCCAGAACTCTCCTGTATGAGG - Intergenic
916625528 1:166551848-166551870 AGCAGGAGCTCTCCTGTATTCGG + Intergenic
916731521 1:167571301-167571323 TGCTGGAGCTCTCCTGTATAAGG + Intergenic
916848943 1:168683633-168683655 AGTAGAAACGCTCCTGTATAGGG + Intergenic
916938628 1:169656998-169657020 AGCTGGAGCACTCCTGTATGAGG - Intergenic
916985867 1:170191220-170191242 AGCTGGAACACACCTGTAGGAGG + Intergenic
917009697 1:170457449-170457471 AGCCAGAGCTCTCCTGTATAAGG + Intergenic
917060491 1:171032694-171032716 AGTAGGATCGCTCTTGTATAGGG + Intronic
917269700 1:173259074-173259096 AGTGGGAATGCTCCTGTATAAGG - Intergenic
917274713 1:173319592-173319614 AGATGGAACTCTCCTGTATGAGG - Intergenic
917295617 1:173516082-173516104 AGTAGGAACGCTCCTGTATAGGG + Intronic
917356361 1:174130883-174130905 AGTAGGATCACTCCTGTATAGGG + Intergenic
917582304 1:176391525-176391547 AGTAGGATTGCTCCTGTATAGGG + Intergenic
917875413 1:179282529-179282551 TTCAGGAAAACTCCTGTAAAGGG - Intergenic
918160110 1:181890131-181890153 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
918167160 1:181961330-181961352 AGCCGGAACTCTCCTGTATGAGG + Intergenic
918168809 1:181975536-181975558 AGTAGGATCACTCCTGTGTAGGG - Intergenic
918631999 1:186730000-186730022 AGCCGGAGCTCTCCTGTATGAGG + Intergenic
918943239 1:191027584-191027606 AGTAAGATCACTCCTGTATAGGG - Intergenic
919231541 1:194780255-194780277 AGTGGGAACACTCTTTTATAAGG - Intergenic
919586556 1:199447565-199447587 AGTAGGATCACTCCTGTATAGGG + Intergenic
920402850 1:205687557-205687579 ATCAGAAACACTTCTGTAAAGGG + Intergenic
920428747 1:205900159-205900181 AGCCAGAACTCTCCTGTATGAGG - Intergenic
921631425 1:217437970-217437992 AGCTGGAGCTCTCCTGTATGAGG - Intronic
921962310 1:221048171-221048193 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
922379947 1:225013370-225013392 AGCCGGAGCTCTCCTGTATGAGG + Intronic
922691995 1:227700364-227700386 AGCTGGAACTCTCCTGTATGAGG - Intergenic
923061166 1:230476034-230476056 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
923421809 1:233823015-233823037 AGCTGGATCTCTCCTGTATTAGG - Intergenic
923658302 1:235937402-235937424 AACAGGAACCCTACTGTTTAAGG + Intergenic
924412403 1:243819723-243819745 AGCAGGAATGCTCCTATATAAGG - Intronic
924779339 1:247132002-247132024 AGTAGCATCACTCCTGAATAGGG - Intronic
924834465 1:247635115-247635137 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1062761860 10:28491-28513 AGCTGGAACGCTCCTGTAGGAGG - Intergenic
1064370400 10:14747713-14747735 AGCAGGAACACTCCTGTATAAGG + Intronic
1064757933 10:18588514-18588536 AGCTGGAACTCTCCTGCATGAGG - Intronic
1065120914 10:22529882-22529904 AGCCGGAGCTCTCCTGTATGAGG + Intergenic
1066042858 10:31568310-31568332 AGCCGGAGCTCTCCTGTATGAGG + Intergenic
1066159742 10:32715133-32715155 AGCTGGAGCTCTCCTGTATGAGG - Intronic
1066993412 10:42539117-42539139 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1067162102 10:43835971-43835993 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1067207593 10:44233235-44233257 AGTAGGATCGCTCCTGTATAGGG + Intergenic
1067236303 10:44453606-44453628 AGCAAGAACTCTCCTGTATGTGG + Intergenic
1067252097 10:44594872-44594894 AGCTGGAACTCTCCTATATGAGG - Intergenic
1067923281 10:50481263-50481285 AGCTGGAACACTCCTGTATAAGG - Intronic
1068369546 10:56095444-56095466 AGTTGGAGCTCTCCTGTATAAGG + Intergenic
1068469880 10:57447882-57447904 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1069120747 10:64566864-64566886 AGCTGGAACTCCCCTGTATGAGG + Intergenic
1069371012 10:67747340-67747362 AAGAGGAATGCTCCTGTATAAGG - Intergenic
1070234384 10:74608635-74608657 AGCTGGAGCTCTCCTGTATGAGG + Intronic
1071059141 10:81548831-81548853 AGTAGGATCGCTCCTGTATAGGG - Intergenic
1071071369 10:81697622-81697644 AGTAGGATCACTCCTGTATAGGG - Intergenic
1071134495 10:82437969-82437991 AGTAGGATCACTCCTGAATAGGG + Intronic
1071401707 10:85279789-85279811 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1072024982 10:91446110-91446132 AGCTGGAGCTCTCCTGTATGTGG - Intronic
1072854764 10:98935692-98935714 AGCTGGAGCTCTCCTATATAAGG + Intronic
1072876258 10:99175857-99175879 AGCTGGATCTCTCCTGTATGAGG - Intronic
1073586537 10:104715989-104716011 AGCAAGGAGACTCCTGTAAATGG - Intronic
1074795429 10:116938570-116938592 AGCTGGAGCTCTCCTGTATGAGG + Intronic
1074985091 10:118651678-118651700 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1074993076 10:118728786-118728808 TGCAGAAAAACTCCTGTTTAAGG - Intronic
1075172300 10:120127406-120127428 AGTAGGATTGCTCCTGTATAGGG + Intergenic
1075230501 10:120671958-120671980 AGCAGGAATGCTCCTGTATAAGG - Intergenic
1075963430 10:126588412-126588434 GGCTGGAACACTCCTGTAGGAGG - Intronic
1076185207 10:128441092-128441114 AGTAGGAACGCTCCCATATAGGG - Intergenic
1077651596 11:3978076-3978098 AGCAGGATCACACATTTATAGGG + Intronic
1077855138 11:6116327-6116349 AGTGGGAACGCTCCTGTATAAGG - Intergenic
1078366688 11:10712392-10712414 GGCAGGGGCACTCCTGCATAAGG - Intergenic
1078691318 11:13583037-13583059 ACCAGAAATGCTCCTGTATAGGG - Intergenic
1078743344 11:14089538-14089560 AGCTGGAGCTCTCCTGTATGAGG + Intronic
1079426134 11:20343398-20343420 AGTAGGATCACTCCTGTATAGGG - Intergenic
1079481903 11:20890079-20890101 AGTAGGATTGCTCCTGTATAGGG - Intronic
1079587975 11:22149757-22149779 AGCAGGGATGCTCCTGTGTAAGG + Intergenic
1079800348 11:24860520-24860542 AGTAGGATCACTCCTGTATAGGG - Intronic
1080334619 11:31181451-31181473 AGCTGGAGCCCTCCTGTATGTGG - Intronic
1080783043 11:35449052-35449074 AGCTGGAACTCTCCTGTATGAGG + Intronic
1080977223 11:37357302-37357324 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1081118350 11:39232800-39232822 AGCCGGAACTTTCCTGTATGAGG - Intergenic
1081454864 11:43211997-43212019 AGTAGGATCACTCCTGTAAAGGG + Intergenic
1081592998 11:44438055-44438077 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1082755919 11:57076330-57076352 ACCAGGAACACCCATGTCTAAGG - Intergenic
1082872060 11:57952942-57952964 AGCCAGAGCTCTCCTGTATAAGG + Intergenic
1083510295 11:63202892-63202914 AGCTGGAGCTCTCCTGTATGAGG - Intronic
1084098640 11:66930441-66930463 AGCAGGAACATTCTTACATATGG - Intronic
1085066373 11:73499079-73499101 AGTAGGATTGCTCCTGTATAGGG - Intronic
1085683718 11:78602838-78602860 AGCAGGAGCTCTCCTGTGTGAGG + Intergenic
1085908962 11:80798533-80798555 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1086559497 11:88151252-88151274 AGAAGGAAAACTCAAGTATAAGG - Intronic
1087316936 11:96614536-96614558 AGTAGGAATGCTCCTATATAGGG + Intergenic
1087830899 11:102819298-102819320 AGCAGGAGCTCTCCTGTATGAGG + Intergenic
1087831303 11:102822198-102822220 AGCCGGAGCTCTCCTGTATGAGG + Intergenic
1088034549 11:105296139-105296161 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1088167542 11:106956702-106956724 AGTAGGATGACTCCTGTATAGGG + Intronic
1088697798 11:112383094-112383116 AGTAGGATCACTCCTGCATAGGG - Intergenic
1089285394 11:117404557-117404579 AGCTGGAGCTCTCCTGTATGAGG + Intronic
1089397366 11:118145217-118145239 AGCAGGAAGAGGCCTGTGTAAGG + Exonic
1089765949 11:120765856-120765878 AGCTGGAGCTCTCCTGTATGAGG + Intronic
1089882376 11:121787215-121787237 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1090321233 11:125845204-125845226 AGCTGGAATGCTCCTGTATGAGG - Intergenic
1090494761 11:127199858-127199880 AGCAGGAACATTCTTGGATTTGG + Intergenic
1090720489 11:129467777-129467799 AGCCAGAGCTCTCCTGTATAAGG - Intergenic
1090734500 11:129599049-129599071 AGTAGGAACACTCCTGTATAGGG - Intergenic
1090811769 11:130250514-130250536 AGCCGGAGCTCTCCTGTATGAGG - Intronic
1090928401 11:131273154-131273176 AGCTGGACCTCTCCTGTATGAGG + Intergenic
1091089943 11:132762216-132762238 AGCTGGAGCTCTCCTGTATGAGG + Intronic
1091213449 11:133884664-133884686 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1092258267 12:6938728-6938750 AGCTGGATCACTGCTGTACAGGG - Exonic
1092443094 12:8527114-8527136 AGTAGGATCACTCCTGTATAGGG + Intergenic
1092566675 12:9673465-9673487 AGCCGGAACTCTTCTGTATGAGG + Intronic
1092639861 12:10493961-10493983 AGTAGGATCACTCCTGTATAGGG - Intergenic
1092703332 12:11257067-11257089 AGCCAGAACTCTCCTGTATAAGG - Intergenic
1093303376 12:17479834-17479856 AGTAGGAATGCTACTGTATAGGG - Intergenic
1093340392 12:17967002-17967024 AGCGGAAACACTCCTGTATAAGG + Intergenic
1093413587 12:18895648-18895670 AGTAGGGTCACTCCTGTATAGGG + Intergenic
1093522574 12:20067475-20067497 AGTAGGATCGTTCCTGTATAGGG - Intergenic
1093808531 12:23464954-23464976 AGTAGGATTACTCCTATATAGGG - Intergenic
1093835523 12:23824516-23824538 AGCCGGATCTCTCCTGTATGAGG + Intronic
1094054702 12:26256872-26256894 AGTAGGATCACTCCTATATAGGG - Intronic
1094139957 12:27171279-27171301 AGCTAGAGCTCTCCTGTATAAGG + Intergenic
1094431989 12:30379948-30379970 AGTGGGAACATTCCTGTATAAGG + Intergenic
1094733026 12:33200257-33200279 AGCCGGAGCTCTCCTGTATGCGG + Intergenic
1094776313 12:33732039-33732061 AGTAGGATCTCTCCTGTATAAGG + Intergenic
1095130688 12:38538872-38538894 AGCAGGATCACTTCTTTATATGG - Intergenic
1095230298 12:39731555-39731577 AGCTGGAGCTCTCCTGTATGTGG + Intronic
1095320315 12:40819101-40819123 AGTAGGATCGCTCCTGTATAGGG + Intronic
1095356501 12:41280949-41280971 AGCTGGAGCTCTCCTGTATGAGG - Intronic
1095778953 12:46037591-46037613 AGCAGGATCTCTCTTGTATGAGG - Intergenic
1095917901 12:47498296-47498318 AGCTGGACCTCTCCTGTATGAGG - Intergenic
1097460555 12:59856873-59856895 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1098193555 12:67976473-67976495 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1098201761 12:68063899-68063921 AGTAAGAACACTCCTGTATAAGG + Intergenic
1098780241 12:74677120-74677142 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1099502610 12:83432422-83432444 AGTAGGAATGCTCCTGGATAGGG + Intergenic
1099550961 12:84043161-84043183 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1099793193 12:87363091-87363113 AGTAGGATCGCTCCTGTATAGGG + Intergenic
1099878514 12:88437707-88437729 AGCCGGAGCTCTCCTGTATGAGG - Intergenic
1100028194 12:90153889-90153911 AGTAGGATCGCTCCTATATAGGG - Intergenic
1100111127 12:91243288-91243310 AGCCGGAACTCTCCTGTATGAGG - Intergenic
1100768655 12:97897711-97897733 AGCTGGAGCTCTCCTGTATGTGG + Intergenic
1101066602 12:101027899-101027921 AGTAGGATCACTCCTGTATAGGG - Intronic
1101069779 12:101062288-101062310 AGCTGGAGCTCTCCTGTATGAGG + Intronic
1101296163 12:103425422-103425444 AGCTGGAGCTCTCCTGTATGAGG - Intronic
1101487921 12:105184659-105184681 AGCTGGAACTCTCCTGTATGAGG + Intronic
1101595876 12:106163925-106163947 AGCCGGAGCTCTCCTGTATGAGG - Intergenic
1103169075 12:118798537-118798559 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1103330809 12:120153028-120153050 GTCAGGAACACTCCTGGAGAGGG - Intronic
1104108008 12:125681521-125681543 ACCATGAACAATCCTGTTTATGG + Intergenic
1104687770 12:130799916-130799938 GGCAGGAACAATCCTGTGTGTGG + Intronic
1105355193 13:19653166-19653188 AGCCGGAGCTCTCCTGTATGAGG - Intronic
1105668386 13:22586257-22586279 AGTAGGAACACTCCTATATAGGG + Intergenic
1106361809 13:29038445-29038467 AGCCGGAGCTCTCCTGTATGAGG + Intronic
1106983787 13:35321498-35321520 AGCTGGAGCTCTCCTGTATGAGG + Intronic
1107648245 13:42517023-42517045 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1107661316 13:42642750-42642772 AGAGGGAACACTCCTGTATAAGG + Intergenic
1107673077 13:42766914-42766936 AGAAGGAACTATCCTGTATGAGG + Intergenic
1107700493 13:43042420-43042442 AGCAGGCACTCTCCTGTGTTAGG + Intronic
1107970772 13:45640581-45640603 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1108048728 13:46408472-46408494 AGCAAGAGCTCTCCTGTATGAGG + Intronic
1108144741 13:47464309-47464331 AGTAGGATCGCTCCTGTATAGGG - Intergenic
1108160472 13:47633035-47633057 CGTAGGAGCACTCCTGTTTAGGG - Intergenic
1108235125 13:48394982-48395004 AGCTGGAACTCTCCTGTATGAGG - Intronic
1108304682 13:49119090-49119112 AGCTGGAGCTCTCCTGTATGAGG - Intronic
1108673961 13:52720708-52720730 AGCCGGAGCTCTCCTGTATGAGG + Intronic
1108815567 13:54286729-54286751 AGTAGGATTGCTCCTGTATAGGG + Intergenic
1109097213 13:58133911-58133933 AGCAGGAATATTCCTGTATAAGG + Intergenic
1109328726 13:60901073-60901095 ACCAGGAGCTCTCCTGTATGAGG - Intergenic
1109541260 13:63781817-63781839 AGCAAGAGCTCTCCTGTATGAGG + Intergenic
1109731630 13:66420408-66420430 AGCTGGAGCTCTCCTGTATGAGG - Intronic
1110020026 13:70458041-70458063 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1110389786 13:74960193-74960215 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1110567063 13:76967700-76967722 AGTAGGAATGCTCCTGTATAGGG + Intergenic
1110824757 13:79958823-79958845 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1110836857 13:80093510-80093532 GGTAAGAACACGCCTGTATAGGG + Intergenic
1110878685 13:80542675-80542697 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1112913771 13:104522116-104522138 GGCAGGAACACTCCAGTATGAGG + Intergenic
1114695407 14:24623105-24623127 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1114817745 14:25979898-25979920 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1115008105 14:28511176-28511198 AGCCAGAACTCTCCTGTGTAAGG + Intergenic
1115124274 14:29973074-29973096 AGCTGGAGCTCTCCTGTATGAGG - Intronic
1115162268 14:30409853-30409875 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1115359727 14:32487945-32487967 AGCTGGAGCTCTCCTGTATGAGG + Intronic
1115511353 14:34140376-34140398 AGCTGGAGCTCTCCTGTATGAGG - Intronic
1115690945 14:35843587-35843609 AGCTGGAGCTCTCCTGTATGAGG + Intronic
1115736155 14:36332365-36332387 AGCAGGACCTCTCCTCCATATGG - Intergenic
1115927286 14:38449406-38449428 AGTGGGAATGCTCCTGTATAAGG - Intergenic
1116074204 14:40089245-40089267 AGCCGGAGCTCTCCTGTATGAGG - Intergenic
1116572359 14:46534493-46534515 AGCCAGAGCTCTCCTGTATAAGG + Intergenic
1116676997 14:47919572-47919594 AGCAGGAACGATCCTGTATAAGG + Intergenic
1117466438 14:55999465-55999487 AGCCGGAGCTCTCCTGTATGAGG + Intergenic
1117600084 14:57365650-57365672 AGCCAGAGCTCTCCTGTATAAGG - Intergenic
1117624309 14:57619276-57619298 AGCCAGAGCACTCCTGTATGAGG - Intronic
1117960441 14:61156588-61156610 AGCAGGAACACTCCTAAACCTGG - Intergenic
1118478973 14:66144388-66144410 AGTAGGATCACTCTTGTATAGGG - Intergenic
1118523639 14:66616633-66616655 AGTAGGATTGCTCCTGTATAGGG + Intronic
1118530759 14:66702372-66702394 AGTAGGATCGCTCCTGTATAGGG - Intronic
1118926928 14:70199681-70199703 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1120137345 14:80885362-80885384 AGCCGGAGCTCTCCTGTATGAGG - Intronic
1120271712 14:82321491-82321513 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1120368930 14:83607558-83607580 AGCAGGAATGCTCCTGTGTAAGG + Intergenic
1120449968 14:84654976-84654998 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1120770184 14:88370605-88370627 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1120773763 14:88410801-88410823 AGCCGGAGCTCTCCTGTATGAGG + Intronic
1121706872 14:96002688-96002710 AGTAGGAGTGCTCCTGTATAGGG - Intergenic
1123480909 15:20629825-20629847 TGCTGGAGCACTCCTGTATGAGG - Intergenic
1123637102 15:22370540-22370562 TGCTGGAGCACTCCTGTATGAGG + Intergenic
1124046458 15:26155422-26155444 AGCAGGAATGCTCCTGTATAGGG + Intergenic
1124197011 15:27639873-27639895 AGTGGGAATGCTCCTGTATATGG - Intergenic
1124474593 15:30022274-30022296 AGCCGGAGCTCTCCTGTATGTGG + Intergenic
1125122264 15:36175927-36175949 AGCCAGAACATTCATGTATAAGG - Intergenic
1125373252 15:39000511-39000533 AGCCGGAATGCTCCTGTATGAGG - Intergenic
1125784378 15:42302088-42302110 AGCCGGAGCTCTCCTGTATGAGG - Intronic
1126236804 15:46394949-46394971 AGCTGGAACTCTCCTGTATGAGG - Intergenic
1126267829 15:46775076-46775098 ATCAGGAAGAAACCTGTATAAGG + Intergenic
1126552925 15:49953129-49953151 AGTAGGATCACTCTTGTATAGGG + Intronic
1127687627 15:61364534-61364556 AGTAGGATTGCTCCTGTATAGGG + Intergenic
1129566946 15:76633339-76633361 AGCTGGAACACTCCTGTATGAGG + Intronic
1130251136 15:82300994-82301016 AGCAGGAACACACCTTTCTAGGG - Intergenic
1130848346 15:87768285-87768307 TGTAGGAATGCTCCTGTATAGGG - Intergenic
1136643449 16:31588440-31588462 AGCAAGAACTCTCCTATATAAGG + Intergenic
1138151626 16:54662397-54662419 AGCTGGAGCTCTCCTGTATAAGG - Intergenic
1138799813 16:60013521-60013543 AGCTGGAACTCTCCTGTATGAGG - Intergenic
1139169623 16:64615259-64615281 AGTAGGATCACTCCTATATAGGG + Intergenic
1139618119 16:68113503-68113525 GGCTGGAACGCTCCTGTATCAGG + Intronic
1141246042 16:82308816-82308838 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1142911650 17:3098247-3098269 AGTAGGTTCACTCCTGTATAGGG - Intergenic
1142953831 17:3506626-3506648 AGCAAGAAAACTCCTGTCTAGGG - Intronic
1143189260 17:5029803-5029825 AGTGAGAACACTCCTGTACAAGG - Intergenic
1143373662 17:6455238-6455260 AGCAGGAAAACGCCTGTGTCGGG + Exonic
1144120898 17:12151203-12151225 AGCCTGAACGCTCCTGTAGAAGG - Intergenic
1144371847 17:14598493-14598515 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1146817333 17:35953481-35953503 AGCCGGAGCGCTCCTGTATGAGG + Intergenic
1146825859 17:36022941-36022963 AGCCGGAGCTCTCCTGTATGAGG + Intergenic
1148981106 17:51575443-51575465 AGCTGGAACTCTCCTATATGAGG - Intergenic
1149174522 17:53853457-53853479 AGTAGGATCGCTCCTGTATAGGG - Intergenic
1149231940 17:54544768-54544790 AGCTGGAACTCTCCTGAGTAAGG - Intergenic
1149242094 17:54662918-54662940 AGTAGGATCACTCCTGTATAGGG + Intergenic
1149281198 17:55107823-55107845 AGCAGGAGCTCTCCTGTATGAGG + Intronic
1149395199 17:56234208-56234230 TGCAGTAACACACCTTTATATGG + Intronic
1150034433 17:61778767-61778789 AGCAGGAACACTCTGGCATTTGG + Intronic
1150190409 17:63232669-63232691 AGCGGGAACCCTCCTGTATAAGG + Intronic
1150196435 17:63304500-63304522 AGTAGGAACGCTTCTGTATAGGG + Intronic
1150545860 17:66156119-66156141 AGCCGGAGCTCTCCTGTATGAGG - Intronic
1151064100 17:71131397-71131419 AGCCAGAACTCTCCTGTATGAGG + Intergenic
1152954768 18:28821-28843 AGCTGGAACGCTCCTGTAGGAGG - Intergenic
1153059306 18:979498-979520 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1153798538 18:8647462-8647484 AGCTGGAGCTCTCTTGTATAAGG - Intergenic
1154101471 18:11478852-11478874 AGCCGGAGCTCTCCTGTATGAGG + Intergenic
1155117435 18:22783669-22783691 AGCAGAAAAGCTCCTGTATAAGG + Intergenic
1155429904 18:25744164-25744186 AGCTGGAATGCTCCTGTATAAGG - Intergenic
1155762975 18:29589251-29589273 AGTAGGAATGCTCCTGTATAGGG - Intergenic
1156110935 18:33726350-33726372 ACCAGGAACACTAGTATATAGGG - Intronic
1156566446 18:38196855-38196877 TGCATGAACACTCTTTTATAAGG + Intergenic
1156778544 18:40822361-40822383 AGTAGGATCGCTCCTGTATAGGG - Intergenic
1157178792 18:45477387-45477409 AGCCGGAGCTCTCCTGTATGAGG + Intronic
1162182578 19:8880155-8880177 AGTAGGATCGCTCCTGTGTAGGG - Intronic
1163897339 19:20071072-20071094 AGTAGGATCACTCCTGTATAGGG - Intergenic
1163949588 19:20571580-20571602 AGTAGGATCACTCCTGTATAGGG + Intronic
1163958294 19:20664264-20664286 AGTAGGATCGCTCCTGTATAGGG + Intronic
1164163788 19:22650334-22650356 AGTAGGAACACAGCTGTATAGGG + Intronic
1164265239 19:23609982-23610004 AGCCTGAACTCTCCTGTATGAGG + Intronic
1165254520 19:34567619-34567641 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1166904853 19:46101137-46101159 GGTAGGAACGCTTCTGTATAAGG + Intergenic
925245233 2:2376835-2376857 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
925729032 2:6904225-6904247 AGCTGGAACTCTCCTGTATGAGG + Intergenic
926453919 2:13040682-13040704 AGCTGGAACGCTCCTGTATGAGG - Intergenic
926508664 2:13745893-13745915 AGCTGGCACTCTCCTGTATGAGG - Intergenic
926892074 2:17647479-17647501 ACCAGGACCACTCATGCATAAGG + Intronic
927182868 2:20459342-20459364 AGCCGGAGCTCTCCTGTATGAGG - Intergenic
928750731 2:34467246-34467268 AGCAGTAGCTCTCCTGTATGAGG - Intergenic
928803777 2:35125906-35125928 AGTAGGATCACTCTTGCATAGGG - Intergenic
928880251 2:36089123-36089145 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
929256065 2:39813077-39813099 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
929333453 2:40712330-40712352 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
929370982 2:41223346-41223368 AATAGGATCACTCCTGTATAGGG - Intergenic
929549778 2:42882308-42882330 ACCAGGAGCACTACTGTCTAAGG - Intergenic
930175983 2:48302347-48302369 AGCTGGAACTCTCTTGTATGAGG + Intergenic
930545849 2:52766220-52766242 AGTAGGATCATTCCTGTATAGGG - Intergenic
930581417 2:53216872-53216894 AATAGGAATGCTCCTGTATAAGG + Intergenic
931538747 2:63305329-63305351 AGCAGGAGCTCTCTTGTATGAGG - Intronic
931560498 2:63555573-63555595 AGTGGGAATGCTCCTGTATAAGG - Intronic
932826819 2:74948434-74948456 AGTAGGATCGCTCCTGTATAGGG - Intergenic
933052132 2:77612684-77612706 AGCTGGAACACTCCTGCATGAGG - Intergenic
933166561 2:79083162-79083184 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
933602459 2:84347466-84347488 AGTAGGACCACTCCTGTATAGGG + Intergenic
934479049 2:94618366-94618388 ATCAGGAACACTCCTGTATAAGG + Intergenic
934698827 2:96422331-96422353 ATCTGGAACTCTCCTGTATGAGG + Intergenic
934810977 2:97276248-97276270 AGTAGAAATGCTCCTGTATAAGG - Intergenic
934826715 2:97431691-97431713 AGTAGAAATGCTCCTGTATAAGG + Intergenic
935063165 2:99625549-99625571 AGCAGGAAATCTCCTGCACATGG - Intronic
935961570 2:108430180-108430202 AGCTGGAGCTCTCCTGTATCAGG - Intergenic
936624191 2:114130791-114130813 AGCAGGACCAATCCTTTATATGG + Intergenic
936849013 2:116873633-116873655 AATAGGATTACTCCTGTATAGGG + Intergenic
936999890 2:118456685-118456707 AGCCAGAGCTCTCCTGTATAAGG + Intergenic
938952241 2:136266153-136266175 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
939109791 2:137992760-137992782 AGTAGGAGCACTCCTGTATAGGG - Intronic
939391204 2:141571132-141571154 AATAGGATCACTCCTGTATAGGG - Intronic
939809044 2:146808589-146808611 AGTAGGATCACTCCTGTATAGGG - Intergenic
939860561 2:147415340-147415362 AGTAGGAATGCTTCTGTATAGGG + Intergenic
939876617 2:147585864-147585886 AGCCAGAGCTCTCCTGTATAAGG + Intergenic
939937692 2:148313056-148313078 AGCTGGAGCTCTCCTGTATGGGG + Intronic
940124935 2:150312051-150312073 AGCCAGAACTCTCCTGTATGAGG - Intergenic
940273307 2:151914898-151914920 AGCAGGATCCCTCCTGTATAGGG + Intronic
940410812 2:153360949-153360971 AGTAGGAGTGCTCCTGTATAGGG - Intergenic
940602677 2:155880942-155880964 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
941088466 2:161146741-161146763 AGTAGGAATGCTCCTATATAGGG + Intronic
941119668 2:161513911-161513933 AGCTGGAGCTCTCCTGTATGAGG - Intronic
941694297 2:168534646-168534668 AGTAGGATCACTCCTGTATAGGG + Intronic
942407297 2:175669050-175669072 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
942411121 2:175709845-175709867 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
942856592 2:180556054-180556076 AAAGGGAACACTTCTGTATAAGG - Intergenic
942953612 2:181749943-181749965 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
943147617 2:184065550-184065572 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
943240296 2:185376414-185376436 AGTAGGAGCTCTCCTGTATGAGG + Intergenic
943409868 2:187533300-187533322 AGCTGGAGCTCTCCTGTATGAGG - Intronic
943512389 2:188841361-188841383 AGCCGGAGCTCTCCTGTATGAGG - Intergenic
943514117 2:188862988-188863010 AGTAGGATCGCTCCTGTATAGGG - Intergenic
944292116 2:198018967-198018989 AGCCGGAACTCCCCTGTATGAGG - Intronic
944385185 2:199155529-199155551 AGTAGGATTGCTCCTGTATAGGG - Intergenic
944439340 2:199726823-199726845 GGTGGGAACACTCCTGTATAAGG + Intergenic
944764440 2:202849883-202849905 AGCTGGAACTCTCCTGTATGAGG - Intronic
945024272 2:205605662-205605684 AGCAGGAATGCTCCTGTATAAGG + Intronic
945164389 2:206927135-206927157 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
945439669 2:209864266-209864288 AGTAGGATCACCCCTTTATAGGG + Intronic
945628177 2:212237483-212237505 AGTTGGAGCACTCCTGTATGAGG + Intronic
945945284 2:215989129-215989151 AGCAGGAGCTCTCCTGTATGAGG - Intronic
946648785 2:221868845-221868867 GGCTGGAACACTCCTGTAGGAGG - Intergenic
946913075 2:224485845-224485867 AGCCGGAGCTCTCCTGTATGAGG - Intronic
947681335 2:232036927-232036949 AGCTGGAGCTCTCCTGTATGAGG + Intronic
948838113 2:240636025-240636047 GGCATAAACACTCCTGGATATGG - Intergenic
1168933453 20:1643987-1644009 AGTAGGAGCACTCCTGTGTAGGG + Intronic
1169695693 20:8384947-8384969 AGTAGGATCGCTCCTGTATAGGG + Intronic
1169980670 20:11380240-11380262 AGCAGGATTGCTCCTGTATAGGG - Intergenic
1170011544 20:11728721-11728743 AGCCAGAACACCCCTGTATGAGG - Intergenic
1170133990 20:13053129-13053151 AGCCGGAGCTCTCCTGTATGAGG - Intronic
1170167814 20:13380480-13380502 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1170229310 20:14027817-14027839 AGCCGGAGCTCTCCTGTATGAGG + Intronic
1170496668 20:16931344-16931366 AGTAGGATCGCTCCTGCATAGGG - Intergenic
1170727258 20:18941253-18941275 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1170730054 20:18966148-18966170 AGTAGGAACACTCCTGTATAGGG - Intergenic
1171816833 20:29793022-29793044 AGCTGGAACGCTCCTGTAGGAGG - Intergenic
1171901512 20:30862955-30862977 AGCTGGAACACTTCTGTAGGAGG + Intergenic
1173764503 20:45595431-45595453 AGCTGAAACACTCCTGCATGAGG + Intergenic
1173922630 20:46757714-46757736 AGCAGGACCCCTCCTGCCTAGGG - Intergenic
1174973631 20:55305950-55305972 AGTAGGATCGCTCCTGTATAGGG - Intergenic
1175041030 20:56050628-56050650 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1175484180 20:59333295-59333317 AGCAGAAACACTCATTTATGGGG - Intergenic
1176408784 21:6436549-6436571 AGCAGGTACACACCTGTGCATGG - Intergenic
1176987591 21:15455784-15455806 AGCGAGAACACTCCTGTATAAGG + Intergenic
1177050353 21:16225339-16225361 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1177099241 21:16879537-16879559 AGTAAGAAGGCTCCTGTATAGGG - Intergenic
1177184112 21:17775146-17775168 AGCCGGAGCTCTCCTGTATGAGG + Intergenic
1177332806 21:19683814-19683836 AGTAGGAACACTTCTGTATATGG + Intergenic
1177878858 21:26669000-26669022 AGTAGGATCGCTTCTGTATAGGG + Intergenic
1178007181 21:28234779-28234801 AGCAGGAGGTCTCCTGTATGAGG - Intergenic
1178033554 21:28555456-28555478 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1178393642 21:32220212-32220234 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1179684277 21:43044871-43044893 AGCAGGTACACACCTGTGCATGG - Intergenic
1180320304 22:11313630-11313652 AGCTGGAACGCTCCTGTAGGAGG - Intergenic
1180334884 22:11568903-11568925 AGCTGGAACACTTCTGTAGGAGG + Intergenic
1180596315 22:16975745-16975767 AGCTGGAGCTCTCCTGTATGAGG - Intronic
1181634650 22:24169010-24169032 GGCAGCAACACTCCTGAGTAGGG + Intronic
1182444656 22:30383082-30383104 AGCAGCAACACTCATGTATCAGG - Intronic
1182952415 22:34390222-34390244 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1183742511 22:39676723-39676745 AGCAGGAACACAGCTGCATGAGG - Intronic
1184809642 22:46822663-46822685 AGCAGGATCTGTCCTTTATAGGG + Intronic
949119853 3:373023-373045 AGTAGGATCACTCCTATATAGGG + Intronic
949423455 3:3891026-3891048 AGCTGGAGCTCTCCTGTATGAGG + Intronic
949580535 3:5383687-5383709 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
949592784 3:5510952-5510974 AGTAGGATCATTCCTGTATATGG - Intergenic
949640963 3:6035791-6035813 AGCCGGAGCGCTCCTGTATGAGG + Intergenic
949955130 3:9260936-9260958 AGCTGGAGCACTCCTGTATAAGG - Intronic
950561913 3:13735807-13735829 AGCTGGAGCTCTTCTGTATAAGG + Intergenic
951137321 3:19118655-19118677 ATAAGGAATGCTCCTGTATAGGG - Intergenic
951254417 3:20432529-20432551 AGCTGGAACTCTCCTATATGAGG + Intergenic
951741762 3:25932221-25932243 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
951832242 3:26943331-26943353 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
951957704 3:28275531-28275553 AGTGGGAACGCTTCTGTATAAGG + Intronic
952503710 3:33988880-33988902 AGTAGGATCACTCCTGTGTAGGG + Intergenic
952634096 3:35505841-35505863 AGCAGGATCGGTCCTGTATAGGG - Intergenic
952679353 3:36073703-36073725 GGCCGGAACGCTCCTGTATGAGG + Intergenic
953102269 3:39841861-39841883 AGCTGGAGCTCTGCTGTATAAGG + Intronic
954529175 3:51303829-51303851 AGCAGGAATGCTCCTATATAAGG + Intronic
955414212 3:58678005-58678027 AGCGGGAGCCCTCCTGTATGAGG + Intergenic
955447886 3:59032934-59032956 AGCTGGAGCTCTCCTGTATGAGG - Intronic
956279442 3:67540782-67540804 AGCCGGAGCTCTCCTGTATGAGG - Intronic
956364581 3:68486317-68486339 AGCAAAAACAATCCTGTATATGG - Intronic
956392886 3:68792970-68792992 AGCAGTAGCACAGCTGTATAAGG - Intronic
957268809 3:78002962-78002984 GGTAGGATCACTCCTGTATAGGG + Intergenic
957584260 3:82114297-82114319 AGTAGGATCGCTCCTGTATAGGG + Intergenic
957690053 3:83555668-83555690 AGCCTGAAGACTCCTGTATGAGG + Intergenic
957696750 3:83649577-83649599 AGTAGGAACTCTCCTGTATAAGG + Intergenic
957850376 3:85799789-85799811 AGCTGGAGCTCTCCTGTATGAGG + Intronic
957930869 3:86876568-86876590 AGCCGGAGCTCTCCTGTATGAGG + Intergenic
958257389 3:91340802-91340824 AGCCAGAAGTCTCCTGTATATGG + Intergenic
958261188 3:91383159-91383181 AGCCGGAGCTCTCCTGTATGAGG + Intergenic
958481880 3:94653886-94653908 AGTAGGATTGCTCCTGTATAGGG + Intergenic
958503681 3:94946319-94946341 AGTAGGATCGCTTCTGTATAGGG + Intergenic
958656417 3:97009048-97009070 AGTAGGATCACTCCTGTATAGGG + Intronic
959278283 3:104305035-104305057 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
959453839 3:106534783-106534805 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
959479436 3:106853622-106853644 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
959883464 3:111473303-111473325 AGTGGGAATGCTCCTGTATAAGG + Intronic
960277161 3:115741846-115741868 AGCAGGAATGCTCCAGTATAAGG + Intergenic
960278246 3:115751607-115751629 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
960477187 3:118144559-118144581 AGTAGGATCGCTCCTGTATAGGG + Intergenic
960695632 3:120393660-120393682 AGCAGGTGCATTCCTGTATTGGG - Exonic
960760020 3:121063401-121063423 AGCTGGAGCTCTCCTGTATGAGG + Intronic
960770040 3:121183799-121183821 AGCTGGAGCTCTCCTGTATGAGG - Intronic
960773079 3:121216588-121216610 AGCTGGAGCTCTCCTGTATGTGG + Intronic
962512422 3:136115002-136115024 AGCCAGAACTCTCCTGTATGAGG - Intronic
962765785 3:138561126-138561148 AGCTGGAGCTCTCCTGTATGAGG - Intronic
963346915 3:144105863-144105885 AGCAGCAACAGTCCTTTTTAGGG + Intergenic
963400390 3:144790721-144790743 AGTAGGATCACTCCTGTATAAGG + Intergenic
963461173 3:145616905-145616927 AGTAGGATCACTCCTGTATAGGG + Intergenic
963629223 3:147712564-147712586 AGCCGGAGCTCTCCTGTATGAGG + Intergenic
964007689 3:151851688-151851710 AGTAGGATTGCTCCTGTATAGGG + Intergenic
964010451 3:151885876-151885898 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
964295093 3:155225085-155225107 AGCAGGAATGCTCCTGTATAAGG + Intergenic
964427201 3:156566678-156566700 AGAAGGAAAAGGCCTGTATAAGG + Intergenic
964904912 3:161707811-161707833 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
965263405 3:166511173-166511195 AGTAGGATCACTCCTGTATAGGG - Intergenic
965293110 3:166909297-166909319 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
966255217 3:177909204-177909226 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
966291270 3:178361844-178361866 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
966539558 3:181074777-181074799 AGTAGGATCACTCCTGTATTGGG + Intergenic
966561381 3:181324642-181324664 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
966637834 3:182156111-182156133 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
968358954 3:198133318-198133340 AGCTGGAACGCTCCTGTAGGAGG + Intergenic
968692186 4:1997857-1997879 AGTAGGGTCACTGCTGTATAGGG - Intronic
969164743 4:5298189-5298211 AGCTGGAGCTCTCCTGTATAAGG + Intronic
970106972 4:12595797-12595819 AGCCGGAGCTCTCCTGTATGGGG - Intergenic
970412129 4:15818588-15818610 AGCCGGAGCTCTCCTGTATGAGG - Intronic
970685314 4:18560154-18560176 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
970952672 4:21775382-21775404 AGCAGGATTGTTCCTGTATAGGG + Intronic
971186527 4:24382972-24382994 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
971285965 4:25290525-25290547 AGCAGGAACGGTCTTGTATAAGG + Intergenic
971429982 4:26555919-26555941 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
971574317 4:28254222-28254244 AGTGGGAACACTCTTATATAAGG - Intergenic
971679114 4:29673879-29673901 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
971988780 4:33864660-33864682 AGCCGGAACTCTCCTGTATGAGG - Intergenic
972755643 4:42042811-42042833 AGCTGGAGCTCTCCTGTATGAGG - Intronic
973568038 4:52207962-52207984 AGCCGGAACTCTCCTGTTTGAGG - Intergenic
973584745 4:52378282-52378304 AATAGGATCGCTCCTGTATAGGG - Intergenic
974130446 4:57748137-57748159 AGTGGGAACACTCCTTTATAAGG + Intergenic
974181145 4:58386306-58386328 AGTAGGGTCACTCCTGTATAGGG + Intergenic
974499778 4:62684558-62684580 AGTAGGAATGCTGCTGTATAGGG - Intergenic
974851704 4:67412126-67412148 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
974913176 4:68148278-68148300 AGCAGAAATACTGCTGTATAAGG + Intergenic
974946547 4:68535790-68535812 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
975104192 4:70549330-70549352 AGTAGGAGCACTCCTGTATGAGG - Intergenic
975319865 4:72997650-72997672 AGCAGGAACACTCCTTGCAAAGG - Intergenic
975489914 4:74976677-74976699 AGCAGGAACACTCCTGTATAAGG - Intronic
975532976 4:75420336-75420358 AGCCAGAGCTCTCCTGTATAAGG + Intergenic
976006877 4:80440288-80440310 AGCCGGAGCTCTCCTGTATGAGG - Intronic
976065626 4:81184231-81184253 AGCTGGAGCTCTCCTGTATGAGG - Intronic
976534261 4:86193175-86193197 AGCTGGAGCTCTCCTGTATGAGG + Intronic
977046977 4:92079722-92079744 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
977086091 4:92600800-92600822 AGCAGGAATGCTCCTGTAAAAGG + Intronic
977438891 4:97037496-97037518 AGCTGGAGCACTCCTGTATGAGG + Intergenic
977508937 4:97937801-97937823 AGTAGGAACACTCCTGTATATGG + Intronic
977524262 4:98125581-98125603 AGCTGGAACACTCCTGTATGAGG + Intronic
977632902 4:99263219-99263241 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
977986260 4:103386118-103386140 AGCCAGAACTCTCCTGTATGAGG - Intergenic
977994538 4:103485497-103485519 AGCTGGAGCCCTCCTGTATGAGG - Intergenic
978054983 4:104252677-104252699 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
978078831 4:104567713-104567735 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
978090365 4:104707588-104707610 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
978185983 4:105857813-105857835 AGCTGAAGCTCTCCTGTATAAGG + Intronic
978206231 4:106083662-106083684 AGTAGGATCACTCCTGTATAAGG - Intronic
978327975 4:107579937-107579959 AGCAGGAATGCCCCTGCATAAGG - Intergenic
978656906 4:111075265-111075287 AGTAGGATTGCTCCTGTATAGGG - Intergenic
978940348 4:114429071-114429093 AATAGGAATACTCCTGTATAGGG + Intergenic
979197767 4:117941219-117941241 AGCAGGATTATTCCTATATAGGG + Intergenic
979288378 4:118952283-118952305 AGAAGGAACAATCCTCTATGTGG - Intronic
979581442 4:122365559-122365581 AGCCGGAGCTCTCCTGTATAAGG - Intergenic
979583812 4:122391282-122391304 GGTAGGATCACTCCTGTATAAGG + Intronic
979628305 4:122871575-122871597 AGTAGGATCGCTCCTGCATAGGG - Intronic
979698215 4:123638656-123638678 AGCGGGAGCTCTCCTGTATGAGG + Intergenic
979742465 4:124168226-124168248 AGTGGGAATACTCCTGTATAAGG - Intergenic
979775513 4:124583785-124583807 TGTAGGATCACCCCTGTATAAGG - Intergenic
980151594 4:129055170-129055192 AGCTGGAGCTCTCCTGTATGAGG + Intronic
980171219 4:129292346-129292368 AGCAGGATCTCTCCTGTATGAGG + Intergenic
980744599 4:136998921-136998943 AGTAGGATTGCTCCTGTATAGGG + Intergenic
980787336 4:137572508-137572530 AGTAGGATAGCTCCTGTATAGGG + Intergenic
980864917 4:138542922-138542944 AGTAGGATCAATTCTGTATAGGG - Intergenic
981133910 4:141189302-141189324 AGCTGGAGCTCTCCTGTATGAGG + Intronic
981237621 4:142436481-142436503 AGTAGGAATGCTCCTGTATAGGG - Intronic
981481391 4:145242899-145242921 AGCTGGAGCTCTCCTGTATGTGG + Intergenic
981671619 4:147293197-147293219 AGCCGGAGCTCTCCTGTATGAGG - Intergenic
982663097 4:158229415-158229437 AGTAGGATCATTCCTGTACAGGG + Intronic
982848230 4:160277297-160277319 AGCCGGAGCTCTCCTGTATGAGG - Intergenic
983774843 4:171594448-171594470 AGTGGGAACGCTCCTCTATAAGG + Intergenic
983820988 4:172193250-172193272 GGCAGGAATGCTCCTGTATAGGG - Intronic
983840938 4:172455934-172455956 AGCTGGAGCTCTCCTGTATGAGG - Intronic
984008999 4:174348014-174348036 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
984335086 4:178379681-178379703 AGTTGGATCACTCCTGTATAGGG - Intergenic
984618726 4:181927759-181927781 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
984626037 4:182009155-182009177 AGTAGGATTGCTCCTGTATAGGG + Intergenic
984723410 4:182998063-182998085 AGCAGGAACACTCCTGTATAAGG - Intergenic
984854057 4:184177592-184177614 AGTGGGAATGCTCCTGTATAAGG - Intronic
985204550 4:187521213-187521235 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
986011830 5:3724143-3724165 AGCAGGAACTCTCCTGTATTTGG + Intergenic
986110439 5:4710382-4710404 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
986140732 5:5026955-5026977 AGTAGGATCGATCCTGTATAGGG - Intergenic
986492497 5:8307035-8307057 AGTAGGGTCACTCCTGTATAAGG - Intergenic
987135543 5:14896556-14896578 AGCAGGAAAACTGCTCTAGATGG + Intergenic
987228834 5:15871046-15871068 AGCAAGAGCTCTCCTGTATGAGG - Intronic
987453937 5:18119925-18119947 AGTAGGATTGCTCCTGTATAGGG - Intergenic
987522753 5:19008151-19008173 AGCAGGAACACAGATGTATAAGG + Intergenic
987656611 5:20815365-20815387 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
987687666 5:21225994-21226016 AGCAAGAACTCCCCTGTATGAGG - Intergenic
987988511 5:25180885-25180907 AGTAGCATCACTCCTGTATAGGG + Intergenic
988076512 5:26362178-26362200 AGCAGAAACACTCCTGTATAAGG + Intergenic
988766941 5:34388580-34388602 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
988772508 5:34447195-34447217 AGCCAGAGCTCTCCTGTATAAGG + Intergenic
988970876 5:36465969-36465991 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
989084003 5:37656349-37656371 AGCTGGAGCTCTCCTGTATGAGG + Intronic
989194238 5:38700372-38700394 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
989364024 5:40635195-40635217 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
989825409 5:45848508-45848530 GGCTGGAGCTCTCCTGTATAAGG - Intergenic
990139014 5:52682105-52682127 AATAGGATCGCTCCTGTATAAGG + Intergenic
990178770 5:53136724-53136746 ACCAGGAACACTCCTGCCTGAGG + Intergenic
990230865 5:53712083-53712105 AGCCTGAACACTCCTGTAGAAGG + Intergenic
990620028 5:57549846-57549868 AGTAGGAATGCTCCTGTATAGGG + Intergenic
990837881 5:60042531-60042553 AGCTGGATCTCTCCTGTATGAGG - Intronic
991025650 5:62026666-62026688 AGCCGGAGCTCTCCTGTATGAGG + Intergenic
991271171 5:64783267-64783289 AGCAGGAACAAGCCTTTCTAAGG - Intronic
991283161 5:64939521-64939543 AGCTGGAGCTCTCCTGTATGAGG + Intronic
991652149 5:68866004-68866026 AGCCGGACCACTCCTGTATGAGG - Intergenic
991934830 5:71790802-71790824 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
992292361 5:75292647-75292669 AGCTGGAACTCTCCTGTATGAGG + Intergenic
992316892 5:75565784-75565806 AGCTGGAGCTCTCCTGTATGAGG + Intronic
992571763 5:78065894-78065916 AGCAGGAATGCTCCTGTGTAAGG - Intronic
993255651 5:85587632-85587654 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
993404024 5:87488548-87488570 AGCCGGAGTTCTCCTGTATAAGG - Intergenic
993541705 5:89159914-89159936 AGCCGGAGCTCTCCTGTATGAGG - Intergenic
993587258 5:89746640-89746662 AGTAGGATCACTCCTATATAGGG + Intergenic
993589664 5:89778466-89778488 ATTAGGAACCCTCCTGTACAGGG - Intergenic
993837587 5:92834754-92834776 AACGGAAACACTCCTGCATAAGG + Intergenic
993911632 5:93690788-93690810 AGCCGGAGCTCTCCTGTATGAGG - Intronic
994005091 5:94828357-94828379 AGCTGGAGCTCTCCTGTATGAGG + Intronic
994233460 5:97335801-97335823 AGCTGGAGCAATCCTGTATGAGG + Intergenic
994344597 5:98669317-98669339 AGTAGGATTGCTCCTGTATAGGG - Intergenic
994350758 5:98743035-98743057 AGCGGGAACGCTCCTCTATAAGG - Intergenic
994696548 5:103079457-103079479 AGTAGGAATGCTCCTTTATAGGG + Intergenic
994843096 5:104951458-104951480 AGTAGGAACATTCCTGTATAAGG + Intergenic
995003079 5:107158475-107158497 AGTAGGATCGCTCCTGTATAGGG - Intergenic
995136495 5:108685518-108685540 AGCAAGAGCTCTCCTGTATGAGG + Intergenic
995264089 5:110138495-110138517 AGTAGGAATGCTCCTGTATAAGG + Intergenic
995326144 5:110892458-110892480 AGCCGGAGCTCTCCTGTATGAGG + Intergenic
995808646 5:116080913-116080935 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
996005908 5:118420270-118420292 GGCAGGAATACTTCTGTATAAGG - Intergenic
996130024 5:119770265-119770287 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
996242595 5:121221669-121221691 AGCCAGAGCTCTCCTGTATAAGG - Intergenic
996426536 5:123319718-123319740 AGCTGGAGCTCTCCTATATAAGG + Intergenic
996639149 5:125730989-125731011 AGCAGGAACACTCCTGTATAGGG - Intergenic
996893911 5:128456518-128456540 AGTAGGATCTCTCCTCTATAAGG - Intronic
996953223 5:129152882-129152904 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
996965830 5:129306438-129306460 AGTAGGATTGCTCCTGTATAGGG + Intergenic
996987422 5:129584300-129584322 AGCCAGAACTCTCCTGTATGAGG + Intronic
997067586 5:130580322-130580344 AATAGGATCGCTCCTGTATAGGG - Intergenic
997097522 5:130929757-130929779 AGTAGGATCACTCCTCTATAGGG - Intergenic
997809452 5:136953454-136953476 AGCTGGAGCACTCCTGCATGAGG + Intergenic
998079247 5:139260991-139261013 AACAGGATCACTGCTGTATTGGG - Intronic
998715714 5:144881866-144881888 AGCAGGTACACTAATTTATAAGG - Intergenic
998752014 5:145333174-145333196 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
998755543 5:145375394-145375416 AGTAGAATCATTCCTGTATAGGG + Intergenic
999502299 5:152159716-152159738 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
999556883 5:152752698-152752720 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
999596972 5:153215275-153215297 AGTAGGAACACTCTTGTACAAGG - Intergenic
1000582146 5:163048044-163048066 AGCCGGAGCACTCCTGTATGAGG + Intergenic
1000820117 5:165973059-165973081 AGCCGGAGCTCTCCTGTATGAGG + Intergenic
1000996020 5:167960098-167960120 AGCTGGAGCTCTCCTGTATGAGG + Intronic
1001057854 5:168464245-168464267 AGCAGGAACAGACCTGTATTGGG + Intronic
1001739054 5:174034999-174035021 AGTAGGAATGCTCCTGTATAGGG + Intergenic
1001788900 5:174437509-174437531 AGTAGGATCGCTCCTATATAGGG - Intergenic
1002677238 5:180927058-180927080 AGCCGGAGCTCTCCTGTATGAGG - Intronic
1003416809 6:5917251-5917273 AGCCAGAACTCTCCTGTATGAGG + Intergenic
1004760186 6:18657102-18657124 AGTAATATCACTCCTGTATAGGG - Intergenic
1004944395 6:20596065-20596087 AGCCGGAGCTCTCCTGTATGAGG + Intronic
1005170687 6:22981023-22981045 AGTAGGGTCGCTCCTGTATAGGG - Intergenic
1005670350 6:28099340-28099362 AATAGGAACACTCCTGTATAGGG - Intergenic
1005785771 6:29244375-29244397 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1007858217 6:44879662-44879684 AGCCAGAACTCTCCTGTATGAGG - Intronic
1007912854 6:45533657-45533679 AGCAGGAAGACTCTTGTACATGG + Intronic
1008468181 6:51854346-51854368 AGTAGGATCGCTCCTGTATAGGG + Intronic
1008575383 6:52855955-52855977 AGCCAGAGCTCTCCTGTATAAGG + Intronic
1008773574 6:55008811-55008833 AGTAGGATCATTCCTTTATAGGG + Intergenic
1008785185 6:55159041-55159063 AGCCGGAGCTCTCCTGTATGAGG - Intronic
1008819190 6:55609754-55609776 AGTAGGAATGCTCCTGTATAAGG - Intergenic
1008834332 6:55807894-55807916 AGTAGGAACGCTCCTGTATAGGG + Intronic
1008997915 6:57680221-57680243 AGCCGGAAGTCTCCTCTATATGG - Intergenic
1009182580 6:60536081-60536103 AGCCGGAGCTCTCCTGTATGAGG - Intergenic
1009186403 6:60579559-60579581 AGCCAGAATTCTCCTGTATATGG - Intergenic
1009264189 6:61532529-61532551 AGCTGGAGCTCTCCTGTATGTGG - Intergenic
1009316637 6:62228922-62228944 AGTAGGAACATTCCTGTATAGGG + Intronic
1009336138 6:62492758-62492780 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1009797928 6:68495475-68495497 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1009916708 6:70005576-70005598 AGTAGGATTGCTCCTGTATAGGG + Intronic
1010331369 6:74627032-74627054 AGGAGGATCACTCCTGTATAAGG - Intergenic
1010483141 6:76378888-76378910 AGTAGGATTGCTCCTGTATAGGG + Intergenic
1010945693 6:81970625-81970647 AGTAGGATCACTCCTTTATAGGG - Intergenic
1011065563 6:83321887-83321909 AGCCGGAGCTCTCCTGTATGAGG - Intronic
1011298863 6:85853289-85853311 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1011387604 6:86815039-86815061 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1011776708 6:90739162-90739184 AGCCAGAACTCTCCTGTATGAGG + Intergenic
1011944250 6:92880970-92880992 AGTAGAATCACTCCTGTATAGGG - Intergenic
1012063151 6:94512283-94512305 ATTAGGGTCACTCCTGTATAGGG - Intergenic
1012328928 6:97960032-97960054 AGCAAGCACACTCCTGTCTTGGG - Intergenic
1012644339 6:101660880-101660902 AGCTGGAGCTCTCCTGTATGAGG + Intronic
1012741096 6:103017947-103017969 AGTAGGAATGCTCCTGTATAGGG + Intergenic
1013214831 6:108017791-108017813 CGAAGGAACTCTTCTGTATATGG - Intergenic
1013390327 6:109679690-109679712 AGCGGGAGCTCTCCTGTATGAGG - Intronic
1013453077 6:110303901-110303923 AGCTGGAGCTCTCCTGTATGAGG - Intronic
1013461595 6:110379297-110379319 AGTAGTATCACTCCTGTATAGGG - Intergenic
1013932046 6:115545708-115545730 AGCGGGAACTCTCCTGTGTAAGG - Intergenic
1014084847 6:117330547-117330569 AGTAGGATCGCTCCTGTATAGGG - Intronic
1014129020 6:117810403-117810425 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1014367512 6:120563026-120563048 AGTAGGATTGCTCCTGTATAGGG + Intergenic
1014413332 6:121153398-121153420 AGCTGAAGCTCTCCTGTATAAGG + Intronic
1014422377 6:121261349-121261371 AGTAGGAACGCTCCTGTGTAGGG - Intronic
1014464438 6:121738429-121738451 AGCTGGAACTCTCCTGTATGAGG + Intergenic
1014836479 6:126166539-126166561 AGCCGGAGCTCTCCTGTATAAGG + Intergenic
1014968105 6:127781799-127781821 AGCTGGAGCTCTCCTGTATGAGG + Intronic
1015660099 6:135565987-135566009 AGTAGGAATGCTCCTGTACAGGG + Intergenic
1016590956 6:145742670-145742692 AGCCGGAGCTCTCCTGTATGAGG - Intergenic
1019071831 6:169353277-169353299 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1019113458 6:169737730-169737752 AGTAGGATCACTCCTGTATAGGG + Intergenic
1020557798 7:9691684-9691706 AGCTGGAGCGCTCCTGTATTAGG - Intergenic
1020599014 7:10248569-10248591 AGCTGGAACTCTCCTGTATGAGG - Intergenic
1020762039 7:12279774-12279796 ATCAGGAAACCTCCTATATATGG - Intergenic
1021187055 7:17576412-17576434 AGCTGGAACACTCTTGTATGAGG - Intergenic
1021207945 7:17807701-17807723 AGCTGGAGCTCTCCTGTATGAGG - Intronic
1021322387 7:19227617-19227639 AGCCGGAGCTCTCCTGTATGAGG - Intergenic
1021556821 7:21928050-21928072 AGCCGGATCGCTCCTGTATGAGG - Intronic
1023363624 7:39441113-39441135 AGTAGGATCACTCCTATATAGGG + Intronic
1023757544 7:43433621-43433643 AGCAGGAAGACAGCTGTACAAGG - Intronic
1024495525 7:50041394-50041416 AGCCGGAGCTCTCCTGTATGAGG - Intronic
1024887110 7:54156119-54156141 TGCAGGAAGACTACTCTATAAGG + Intergenic
1025714529 7:63942320-63942342 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1028048987 7:86158849-86158871 AGTAGGATTATTCCTGTATAGGG - Intergenic
1028442588 7:90880657-90880679 AGTAGGACCACTCCTGTATAGGG - Intronic
1028518064 7:91699281-91699303 AGTAGGAATGCTTCTGTATAGGG - Intronic
1028523068 7:91753154-91753176 AGCAGGAATGCTCCTGTATAAGG - Intronic
1028648337 7:93122073-93122095 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1029039566 7:97558247-97558269 AATAGGCTCACTCCTGTATAAGG - Intergenic
1029851027 7:103462151-103462173 AGCCGGAGCTCTCCTGTATGAGG + Intergenic
1029854911 7:103505303-103505325 AGCCGGAGCTCTCCTGTATGAGG - Intronic
1030256598 7:107516597-107516619 AGCTGGAGCTCTCCTGTATGAGG - Intronic
1030325768 7:108217324-108217346 AGCCGGAGCTCTCCTGTATGAGG + Intronic
1030701490 7:112646519-112646541 AGTAGGATCACTCCTGTATAGGG + Intergenic
1030759440 7:113332175-113332197 AGTAGAATCGCTCCTGTATAGGG - Intergenic
1031173255 7:118317724-118317746 AGCTGGAACTCTCCTGTATGAGG + Intergenic
1031453868 7:121955895-121955917 AACAGAAACACTGCTGTATTGGG + Intronic
1031711081 7:125047038-125047060 AGCTGGAGCTCTCCTGTATGGGG - Intergenic
1032295844 7:130638129-130638151 AGCTGGAGCTCTCCTGTATGAGG + Intronic
1032659667 7:133969743-133969765 AGCTGGAGCTCTCCTGTATGAGG + Intronic
1033278298 7:139988869-139988891 AGCAGGAACACTCTTGCTCAGGG + Intronic
1033525694 7:142210924-142210946 AGCTGGAGCTCTCCTGTATGAGG - Intronic
1033868176 7:145718143-145718165 AGTGGGAACATTCCTATATAAGG + Intergenic
1033989475 7:147265737-147265759 AGTAGGAATGCTCCTGGATAAGG - Intronic
1034370696 7:150594137-150594159 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1034715036 7:153234396-153234418 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1037531328 8:19777134-19777156 AGCAGTACCACTCTTGCATATGG + Intergenic
1038073767 8:24046794-24046816 AGTAGGAATGCTCCTATATAGGG - Intergenic
1038243264 8:25830571-25830593 AGTAGGATCTCTCCTATATAGGG + Intergenic
1039025320 8:33252435-33252457 AGCAGGAATGCTCCTGTATAAGG + Intergenic
1039133927 8:34298307-34298329 AGCCGGAGCTCTCCTGTATGAGG - Intergenic
1039265231 8:35816421-35816443 AGTAGGAATGCTCCTGTATAGGG - Intergenic
1039293774 8:36127373-36127395 AGTAGGAGTGCTCCTGTATAGGG + Intergenic
1039685848 8:39801436-39801458 AGTAGGATTACTCCTCTATAGGG + Intronic
1040473784 8:47759529-47759551 AGCTGGAGCCCTCCTGTATGAGG + Intergenic
1040614118 8:49017968-49017990 AGTAGGAATGGTCCTGTATAGGG + Intergenic
1040841898 8:51793061-51793083 GGTGGGAACCCTCCTGTATAAGG - Intronic
1041567240 8:59292916-59292938 AGCAGGAACACACCTTTCTATGG - Intergenic
1041630494 8:60082339-60082361 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1041693939 8:60715722-60715744 AGCAGGGTTTCTCCTGTATATGG + Intronic
1041743152 8:61177559-61177581 AGTAGGAAAGCTCCTGTATAGGG - Intronic
1041747518 8:61224590-61224612 AGTAGGATCGTTCCTGTATAAGG + Intronic
1042070729 8:64930824-64930846 AGCAAGAGCTCTCCTGTATGAGG + Intergenic
1042111011 8:65380681-65380703 AGCCGGAGCTCTCCTGTATAAGG - Intergenic
1042478882 8:69280931-69280953 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1042630028 8:70805985-70806007 AGTAGGATTGCTCCTGTATAGGG - Intergenic
1042759740 8:72257555-72257577 AGTAGCAACACTATTGTATAAGG - Intergenic
1042773722 8:72405891-72405913 AGCCAGAACTCTCCTGTATGAGG - Intergenic
1043223771 8:77699128-77699150 AGTAGTATCATTCCTGTATAGGG + Intergenic
1043233410 8:77830644-77830666 AGTATGAACACTCCTGTATAGGG - Intergenic
1043532516 8:81166396-81166418 AGCCGGAGCTCTCCTGTATGAGG - Intergenic
1043647169 8:82535768-82535790 AGCAGGAGCTCTCCTGTATGAGG + Intergenic
1044090828 8:87998488-87998510 AGCAGTAATACACCTTTATATGG + Intergenic
1044267804 8:90203904-90203926 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1044356076 8:91224607-91224629 AGTAGGATTGCTCCTGTATAGGG + Intronic
1044940173 8:97334543-97334565 AGCAGGAGCTCTCCTGTATGAGG + Intergenic
1045151708 8:99415819-99415841 AGCTGGAGCTCTCCTGTATGTGG + Intronic
1045977872 8:108149785-108149807 AGCAGGAATGCTCCTGCATAAGG - Intergenic
1046067906 8:109218417-109218439 AGCTGGAACTCTCCTGTATGAGG + Intergenic
1046338829 8:112825752-112825774 AGTAGGAACACTCCTGTATAGGG + Intronic
1046702790 8:117419375-117419397 TGCAGGAACATTCCTGTATAAGG - Intergenic
1047151986 8:122274100-122274122 AGTAGGAACGCTCCTGTGTATGG - Intergenic
1047929136 8:129709070-129709092 AGCAGGAATACTTCTGAACAGGG - Intergenic
1048429239 8:134353643-134353665 AGCAGGAATGCTCCTGTATAAGG + Intergenic
1048587630 8:135790262-135790284 AGAAGGATCACTCCTGTATAAGG + Intergenic
1050130071 9:2403074-2403096 AGCTGGAGCGCTCCTGTATGAGG + Intergenic
1050239830 9:3623740-3623762 AGCTGGATCTCTCCTGTATGGGG + Intergenic
1050630179 9:7549966-7549988 AGTAGGATCGCTCCTGTATAGGG - Intergenic
1050637478 9:7627217-7627239 AGCCGGAGCTCTCCTGTATGAGG - Intergenic
1050660819 9:7880595-7880617 AGTGGGAACACTCCTGTATAGGG - Intronic
1050963403 9:11766293-11766315 AGCTGGAACTCTCCTGTATGAGG - Intergenic
1051447319 9:17154544-17154566 AGCCAGAACTCTCCTGTATGAGG + Intronic
1051451663 9:17204577-17204599 AGCAGGAGCTCTCCTGTATGAGG + Intronic
1051548795 9:18305943-18305965 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1051591703 9:18782791-18782813 AGGAAGAACACTCCTGGACAAGG + Intronic
1051611562 9:18967150-18967172 AGCTGGAGCTCTCCTGTATGAGG + Intronic
1051863313 9:21651257-21651279 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1052115670 9:24646260-24646282 AGTAGGAACACTCCTGTATAGGG + Intergenic
1052387079 9:27835282-27835304 AGCAGGAATGCTGCTGTATAAGG + Intergenic
1052628401 9:31005470-31005492 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1052752819 9:32509335-32509357 AGCTGGAGCTCTCCTGTATGAGG - Intronic
1053678781 9:40465199-40465221 AGCAGGAACACTCCTGTATAAGG - Intergenic
1053928766 9:43093552-43093574 AGCAGGAACACTCCTGTATAAGG - Intergenic
1054284942 9:63159743-63159765 AGCAGGAACACTCCTGTATAAGG + Intergenic
1054291859 9:63300737-63300759 AGCAGGAACACTCCTGTATAAGG - Intergenic
1054389877 9:64605280-64605302 AGCAGGAACACTCCTGTATAAGG - Intergenic
1054505837 9:65911096-65911118 AGCAGGAACACTCCTGTATAAGG + Intergenic
1054899240 9:70350560-70350582 AGCAGGAACACTCCCAAAAAAGG + Intronic
1055571857 9:77624506-77624528 AGCTGGAGCTCTCCTGTATGAGG - Intronic
1055818942 9:80238805-80238827 AATAGGAAAGCTCCTGTATAGGG - Intergenic
1056015049 9:82376674-82376696 GGCAGGAACGCTCCTGTATAAGG - Intergenic
1056320991 9:85434152-85434174 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1056385069 9:86090149-86090171 AGCCGGAGCTCTCCTGTATGAGG + Intronic
1056997692 9:91479049-91479071 AGCCGGAGCTCTCCTGTATGAGG + Intergenic
1057460392 9:95255292-95255314 AGCCGGAGCTCTCCTGTATGAGG - Intronic
1058182596 9:101816254-101816276 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1058374379 9:104305615-104305637 ACTAGGATCGCTCCTGTATAGGG - Intergenic
1058530290 9:105899836-105899858 AGTAGGAATGCTCCTGTATAAGG + Intergenic
1058819109 9:108712756-108712778 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1059004135 9:110383486-110383508 AGCAGGAACACCCTTGTATAAGG + Intronic
1059248687 9:112868891-112868913 TGCAGGGACATTCCGGTATAGGG - Exonic
1059262634 9:112993465-112993487 AGCAGGAATGCTCCTGTATACGG + Intergenic
1059466231 9:114470513-114470535 TGCAGGAAGACTCCTGGAAACGG + Intronic
1059596368 9:115724557-115724579 AGTAGGATCGCTCCTGTATAGGG - Intergenic
1059639717 9:116204828-116204850 AGAAGGAACATTACTGTCTAGGG - Intronic
1059860976 9:118461403-118461425 ATCAAGAAAACTCCTGTATTTGG + Intergenic
1059954666 9:119502912-119502934 AGCTGGAGCTCTCCTGTATGAGG - Intronic
1062743088 9:138192451-138192473 AGCTGGAACGCTCCTGTAGGAGG + Intergenic
1062743337 9:138194452-138194474 AGCTGGAACGCTCCTGTAGGAGG + Intergenic
1062743586 9:138196453-138196475 AGCTGGAACGCTCCTGTAGGAGG + Intergenic
1185846201 X:3440639-3440661 AGTAGGATCCCTCCTATATAGGG + Intergenic
1185952560 X:4452358-4452380 AGTAGGATCATTCCTGTACAGGG - Intergenic
1186369938 X:8936795-8936817 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1186431012 X:9504013-9504035 AGTAGGATCACTCCTGCAGAGGG - Intronic
1186740932 X:12517620-12517642 AGCAGGAATGCCCCTGAATAAGG + Intronic
1186774772 X:12854156-12854178 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1187357946 X:18595941-18595963 AGCAGGAAGACTTCTGGACAGGG - Intronic
1187605279 X:20875339-20875361 AGCCAGAACTCTCCTGTATAAGG - Intergenic
1187660940 X:21545655-21545677 AGCTGGAGCTCTCCTGTATGAGG - Intronic
1188084207 X:25883074-25883096 AGCAAGAGCTCTCCTGTATGAGG - Intergenic
1188669858 X:32868980-32869002 AGCAGGAACCTTCCTGTATAAGG - Intronic
1189039685 X:37529863-37529885 AGCTGGAGCTCTCCTGTATGAGG + Intronic
1189571963 X:42307188-42307210 AGTAGGATCACTCCTGTACAGGG - Intergenic
1190505962 X:51125961-51125983 AGCCGGAGCTCTCCTGTATGAGG - Intergenic
1190529688 X:51362005-51362027 GGTAGGATCACTCCTGTATAGGG - Intergenic
1190966337 X:55305108-55305130 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1190995610 X:55605888-55605910 AGCCGGAGCTCTCCTGTATGAGG + Intergenic
1191153119 X:57242192-57242214 AGCTGGAGCTCTCTTGTATAAGG - Intergenic
1191225116 X:58034761-58034783 AGCAGGAACACTCCTGCATAAGG + Intergenic
1191594176 X:62923695-62923717 AGCAGAAACACTCCTGCATGAGG - Intergenic
1191606323 X:63066369-63066391 AGCTGGAGCTCTCCTGTATAAGG - Intergenic
1191785078 X:64908321-64908343 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1191848520 X:65568723-65568745 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1191872870 X:65764796-65764818 AGCCGGAGCTCTCCTGTATGTGG + Intergenic
1192009333 X:67250933-67250955 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1192026420 X:67457164-67457186 AGTAGGATCGCTCCTGTATAGGG - Intergenic
1192701710 X:73481731-73481753 AGCCGGAGCTCTCCTGTATGAGG + Intergenic
1192722307 X:73711973-73711995 AGCAGGAAAACTCCTGCACAAGG + Intergenic
1192741091 X:73893251-73893273 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1192922668 X:75724001-75724023 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1192933889 X:75838667-75838689 AGATGGAGCTCTCCTGTATAAGG + Intergenic
1192944322 X:75949399-75949421 GGCTGGAACAGTCCTGTATGAGG + Intergenic
1192952008 X:76026840-76026862 AGTAGGATCACTCCTGTATAGGG - Intergenic
1192953098 X:76039007-76039029 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1192994078 X:76493388-76493410 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1192997974 X:76532809-76532831 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1192999544 X:76549848-76549870 AGCAGGAGCTCTTCTGTATGAGG + Intergenic
1193003581 X:76590831-76590853 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1193217027 X:78875587-78875609 AACCGGAACGCTCCTGTATGAGG - Intergenic
1193334725 X:80274459-80274481 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1193382085 X:80827576-80827598 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1193404553 X:81084656-81084678 AGCCGGAGCTCTCCTGTATGAGG - Intergenic
1193595357 X:83438972-83438994 AGCAGGAATGTTCCTGTATAAGG + Intergenic
1193605838 X:83567106-83567128 AGTAGGAACTCTTTTGTATAGGG + Intergenic
1193615926 X:83688301-83688323 AGCTGGAGCTCTCCTGTATAAGG + Intergenic
1193768473 X:85560845-85560867 AGTAGGATCACTCCTGTATAGGG + Intergenic
1193878811 X:86896590-86896612 AGCTGGAACTCTCCTTTATGAGG - Intergenic
1194021335 X:88695251-88695273 ACCAGGAGCTCTCCTGTATGAGG - Intergenic
1194021981 X:88702293-88702315 AGTAGGATCGCTCCTGTATAGGG + Intergenic
1194193590 X:90865696-90865718 AGAAGGAACGCTCCTGTATAAGG - Intergenic
1194445956 X:93987117-93987139 AGTAGGAATGCTTCTGTATAGGG - Intergenic
1194596789 X:95868337-95868359 AGTAGGATCACTCCCATATAAGG - Intergenic
1194704286 X:97155833-97155855 AGAAGGAAGACTGATGTATATGG + Intronic
1195147242 X:102029748-102029770 AGTAGGAAAGCTGCTGTATAAGG - Intergenic
1195213037 X:102669249-102669271 AGCCAGAACTCTCCTGTATGAGG + Intergenic
1195435842 X:104842796-104842818 AGCTGGAGCTCTCCTGTATGAGG + Intronic
1195469114 X:105212713-105212735 AGCTGGAGCTCTCCTGTATGAGG - Intronic
1195810552 X:108824617-108824639 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1195948268 X:110238783-110238805 AGCTGGAGCTCTCCTGTATGAGG - Intronic
1195979282 X:110560835-110560857 AGTAGGAACACCACTGTATAGGG + Intergenic
1195983189 X:110601475-110601497 AGTAGGATCACTCCTGTATATGG - Intergenic
1196284447 X:113863490-113863512 AGCAGGAATGCTCTTGTATAAGG + Intergenic
1196381861 X:115099173-115099195 AGCAGGAACACTCCTGTATAAGG - Intergenic
1196517200 X:116628191-116628213 AGTAGGATTGCTCCTGTATAGGG + Intergenic
1196555792 X:117083559-117083581 AGTAGGAACACTCCTGTATATGG + Intergenic
1196558980 X:117123408-117123430 AGCTGGAACTCTCCTGTATGAGG - Intergenic
1197030035 X:121802602-121802624 AGTAGGATCACTCCTGTATAGGG + Intergenic
1197157303 X:123283983-123284005 AGCTGGAGCTCTCCTGTATGAGG - Intronic
1197184823 X:123574230-123574252 AGCCAGAGCACTCCTGTATGAGG - Intergenic
1197350049 X:125372156-125372178 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1197413764 X:126150328-126150350 GGCTGGAACACTCCTGTATGAGG + Intergenic
1197506083 X:127306537-127306559 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1197607020 X:128597079-128597101 AGTAGGAATGCTCCTGTACAGGG + Intergenic
1197614219 X:128674417-128674439 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1198060487 X:133041599-133041621 AGCTGGAATTCTCCTGTATGAGG + Intronic
1198525720 X:137498510-137498532 AGCATGAACACTGATGTTTAAGG - Intergenic
1198758096 X:140001633-140001655 AGCCGGAGCTCTCCTGTATTAGG - Intergenic
1198784400 X:140272289-140272311 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1198841422 X:140861437-140861459 AGCAGGAACTCTCCTGTATAAGG - Intergenic
1199286731 X:146062415-146062437 AGCATGAACCCTCTCGTATAAGG - Intergenic
1199308160 X:146292294-146292316 GGCATGAACACTCCTGTAAAAGG + Intergenic
1199524830 X:148781153-148781175 AGCTGGAGCTCTCCTGTATGAGG + Intronic
1200523953 Y:4247925-4247947 AGCATGAACATTCCTGTATAAGG - Intergenic
1200540201 Y:4448078-4448100 AGAAGGAACACTCCTGTATAAGG - Intergenic
1200548888 Y:4553961-4553983 AGCTGGAGCTCTCCTGTATGAGG + Intergenic
1200639344 Y:5699224-5699246 AGCTGGAATGCTCCTATATAAGG + Intronic
1200731939 Y:6752319-6752341 AGCTGGAACACTCCTGTATGAGG + Intergenic
1201312894 Y:12612763-12612785 AGCTGGAGCTCTCCTGTATGAGG - Intergenic
1201406085 Y:13651960-13651982 AGCCAGAACTCTCCTGTATGAGG + Intergenic
1201490955 Y:14540560-14540582 AGCAAGAGCTCTCCTGTATGAGG - Intronic
1201591297 Y:15617527-15617549 AGCCAGAGCTCTCCTGTATAAGG - Intergenic
1201756756 Y:17494489-17494511 AGCTGGAACGCTCCTGTAGGAGG - Intergenic
1201844797 Y:18411495-18411517 AGCTGGAACGCTCCTGTAGGAGG + Intergenic