ID: 1053678783

View in Genome Browser
Species Human (GRCh38)
Location 9:40465216-40465238
Sequence GGCACTGATGTGATGCCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053678783_1053678791 11 Left 1053678783 9:40465216-40465238 CCTGCTGGCATCACATCAGTGCC No data
Right 1053678791 9:40465250-40465272 GAGCTCAAAAAAGAAGGAGCAGG No data
1053678783_1053678790 5 Left 1053678783 9:40465216-40465238 CCTGCTGGCATCACATCAGTGCC No data
Right 1053678790 9:40465244-40465266 GGGATGGAGCTCAAAAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053678783 Original CRISPR GGCACTGATGTGATGCCAGC AGG (reversed) Intergenic
No off target data available for this crispr