ID: 1053678785

View in Genome Browser
Species Human (GRCh38)
Location 9:40465224-40465246
Sequence CATCACATCAGTGCCCCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053678778_1053678785 22 Left 1053678778 9:40465179-40465201 CCAACAGGGGTCTCCAGGCACCT No data
Right 1053678785 9:40465224-40465246 CATCACATCAGTGCCCCTCTGGG No data
1053678781_1053678785 2 Left 1053678781 9:40465199-40465221 CCTTATACAGGAGTGTTCCTGCT 0: 11
1: 12
2: 69
3: 164
4: 611
Right 1053678785 9:40465224-40465246 CATCACATCAGTGCCCCTCTGGG No data
1053678777_1053678785 25 Left 1053678777 9:40465176-40465198 CCACCAACAGGGGTCTCCAGGCA No data
Right 1053678785 9:40465224-40465246 CATCACATCAGTGCCCCTCTGGG No data
1053678780_1053678785 9 Left 1053678780 9:40465192-40465214 CCAGGCACCTTATACAGGAGTGT No data
Right 1053678785 9:40465224-40465246 CATCACATCAGTGCCCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053678785 Original CRISPR CATCACATCAGTGCCCCTCT GGG Intergenic
No off target data available for this crispr