ID: 1053678790

View in Genome Browser
Species Human (GRCh38)
Location 9:40465244-40465266
Sequence GGGATGGAGCTCAAAAAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053678783_1053678790 5 Left 1053678783 9:40465216-40465238 CCTGCTGGCATCACATCAGTGCC No data
Right 1053678790 9:40465244-40465266 GGGATGGAGCTCAAAAAAGAAGG No data
1053678781_1053678790 22 Left 1053678781 9:40465199-40465221 CCTTATACAGGAGTGTTCCTGCT 0: 11
1: 12
2: 69
3: 164
4: 611
Right 1053678790 9:40465244-40465266 GGGATGGAGCTCAAAAAAGAAGG No data
1053678780_1053678790 29 Left 1053678780 9:40465192-40465214 CCAGGCACCTTATACAGGAGTGT No data
Right 1053678790 9:40465244-40465266 GGGATGGAGCTCAAAAAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053678790 Original CRISPR GGGATGGAGCTCAAAAAAGA AGG Intergenic
No off target data available for this crispr