ID: 1053678791

View in Genome Browser
Species Human (GRCh38)
Location 9:40465250-40465272
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053678783_1053678791 11 Left 1053678783 9:40465216-40465238 CCTGCTGGCATCACATCAGTGCC No data
Right 1053678791 9:40465250-40465272 GAGCTCAAAAAAGAAGGAGCAGG No data
1053678787_1053678791 -10 Left 1053678787 9:40465237-40465259 CCCCTCTGGGATGGAGCTCAAAA No data
Right 1053678791 9:40465250-40465272 GAGCTCAAAAAAGAAGGAGCAGG No data
1053678781_1053678791 28 Left 1053678781 9:40465199-40465221 CCTTATACAGGAGTGTTCCTGCT 0: 11
1: 12
2: 69
3: 164
4: 611
Right 1053678791 9:40465250-40465272 GAGCTCAAAAAAGAAGGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053678791 Original CRISPR GAGCTCAAAAAAGAAGGAGC AGG Intergenic
No off target data available for this crispr