ID: 1053681186

View in Genome Browser
Species Human (GRCh38)
Location 9:40486531-40486553
Sequence GTGGATAGACGGGTGGTTAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053681171_1053681186 17 Left 1053681171 9:40486491-40486513 CCAGGAAGGAGAGGACCCCACCC No data
Right 1053681186 9:40486531-40486553 GTGGATAGACGGGTGGTTAATGG No data
1053681177_1053681186 0 Left 1053681177 9:40486508-40486530 CCACCCCAGCCAAGGGGTGATAT 0: 9
1: 0
2: 1
3: 8
4: 176
Right 1053681186 9:40486531-40486553 GTGGATAGACGGGTGGTTAATGG No data
1053681181_1053681186 -5 Left 1053681181 9:40486513-40486535 CCAGCCAAGGGGTGATATGTGGA 0: 9
1: 0
2: 0
3: 2
4: 80
Right 1053681186 9:40486531-40486553 GTGGATAGACGGGTGGTTAATGG No data
1053681170_1053681186 20 Left 1053681170 9:40486488-40486510 CCTCCAGGAAGGAGAGGACCCCA No data
Right 1053681186 9:40486531-40486553 GTGGATAGACGGGTGGTTAATGG No data
1053681178_1053681186 -3 Left 1053681178 9:40486511-40486533 CCCCAGCCAAGGGGTGATATGTG 0: 9
1: 0
2: 0
3: 8
4: 119
Right 1053681186 9:40486531-40486553 GTGGATAGACGGGTGGTTAATGG No data
1053681182_1053681186 -9 Left 1053681182 9:40486517-40486539 CCAAGGGGTGATATGTGGATAGA No data
Right 1053681186 9:40486531-40486553 GTGGATAGACGGGTGGTTAATGG No data
1053681176_1053681186 1 Left 1053681176 9:40486507-40486529 CCCACCCCAGCCAAGGGGTGATA No data
Right 1053681186 9:40486531-40486553 GTGGATAGACGGGTGGTTAATGG No data
1053681179_1053681186 -4 Left 1053681179 9:40486512-40486534 CCCAGCCAAGGGGTGATATGTGG 0: 9
1: 0
2: 0
3: 6
4: 118
Right 1053681186 9:40486531-40486553 GTGGATAGACGGGTGGTTAATGG No data
1053681175_1053681186 2 Left 1053681175 9:40486506-40486528 CCCCACCCCAGCCAAGGGGTGAT No data
Right 1053681186 9:40486531-40486553 GTGGATAGACGGGTGGTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053681186 Original CRISPR GTGGATAGACGGGTGGTTAA TGG Intergenic
No off target data available for this crispr