ID: 1053695909

View in Genome Browser
Species Human (GRCh38)
Location 9:40639171-40639193
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053695909_1053695922 29 Left 1053695909 9:40639171-40639193 CCAGGCCCTAGTCCTCCCTTCCT No data
Right 1053695922 9:40639223-40639245 GAGGTCATCAGTGCAGGCCATGG 0: 6
1: 10
2: 13
3: 81
4: 356
1053695909_1053695917 10 Left 1053695909 9:40639171-40639193 CCAGGCCCTAGTCCTCCCTTCCT No data
Right 1053695917 9:40639204-40639226 CTCAAAGGCAAGTCCCCATGAGG No data
1053695909_1053695923 30 Left 1053695909 9:40639171-40639193 CCAGGCCCTAGTCCTCCCTTCCT No data
Right 1053695923 9:40639224-40639246 AGGTCATCAGTGCAGGCCATGGG No data
1053695909_1053695915 -5 Left 1053695909 9:40639171-40639193 CCAGGCCCTAGTCCTCCCTTCCT No data
Right 1053695915 9:40639189-40639211 TTCCTGTGTCAACTGCTCAAAGG No data
1053695909_1053695919 23 Left 1053695909 9:40639171-40639193 CCAGGCCCTAGTCCTCCCTTCCT No data
Right 1053695919 9:40639217-40639239 CCCCATGAGGTCATCAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053695909 Original CRISPR AGGAAGGGAGGACTAGGGCC TGG (reversed) Intergenic